Skip to main content

Table 2 Primers used to screen the BAC library and RT-PCR experiments

From: Sequence analysis of two alleles reveals that intra-and intergenic recombination played a role in the evolution of the radish fertility restorer (Rfo)

Name of primer 5'-3' sequence
F24D7-9radF TAAGCTGAGCGAGTGGACTACC
F24D7-9radR AGACTATAAACGCAGCCGCTAC
F24D7-13radF CTTGATTCGGTTCGAGAGCTTA
F24D7-13radR TCCATGGGAACTCGCTTGTGTC
PPRA:20505U22 CTTCTCTCCCAACGTAGTGACA
PPRA:20954L21 CATTCATCCTCCAACTGATAC
Rfocons1047U22 AATTATACGATGAGATGCTTCC
PPRB:13225L22 AAACAGAAGAAAATCTTTGATC
PPR1:21229U22 GATGCCACATAGAGGTATAGTC