Skip to main content

Advertisement

Table 3 qRT-PCR-validated miRNAs and their sequences

From: Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaeaL.)

miRNA Sequence
miR 156 UGACAGAAGAGAGUGAGCAC
miR 157 UUGACAGAAGAUAGAGAGCAC
miR162 UCGAUAAACCUCUGCAUCCAG
miR172 AGAAUCUUGAUGAUGCUGCAU
miR396 UUCCACAGCUUUCUUGAACUG
miRn1 UAGAGGGUCCCCAUGUUCUCA
miRn2 UCACCGUUAAUACAGAAUCCUU
miRn2* AGGAUUCUGUAUUAACGGUGA
miRn3 AAUGUAGAAAAUGAACGGUAU
miRn4 UGCUGGGUGAUAUUGACAGAAG