Skip to main content

Advertisement

Table 2 Novel miRNAs identified from peanut

From: Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaeaL.)

Name Count miRNA sequence Folding energy
ahy-miRn1 656 UAGAGGGUCCCCAUGUUCUCA -65.9
ahy-miRn2 40 UCACCGUUAAUACAGAAUCCUU -70.57
ahy-miRn2* 3 AGGAUUCUGUAUUAACGGUGA -70.57
ahy-miRn3 15 AAUGUAGAAAAUGAACGGUAU -64.6
ahy-miRn4 12 UGCUGGGUGAUAUUGACAGAAG -48.72
ahy-miRn5 7 CUGACCACUGUGAUCCCGGAA -39.5
ahy-miRn6 6 UGACCUUUGGGGAUAUUCGUG -61.9
ahy-miRn7 5 UCAAUCAAUGACAGCAUUUCA -39.42
ahy-miRn8 4 UGGUGAUGGUGAAUAUCUUAUC -38.1
ahy-miRn8* 1 AAGGGAGACGUUUGAAUUAUC -38.1
ahy-miRn9 3 UGGUGAGUCGUAUACAUACUG -30.91
ahy-miRn10 3 AUACUUGAGAGCCGUUAGAUGA -52.8
ahy-miRn10* 1 AUCUAACGACUCUCAGAUAUAAU -52.8
ahy-miRn11 3 UUAUACCAUCUUGCGAGACUGA -49.7
ahy-miRn12 4 UGUUACUAUGGCAUCUGGUAA -40.2
ahy-miRn12* 1 GCCAGGGCCAUGAAUGCAGAU 40.2
ahy-miRn13 3 CGCAAAUGAUGACAAAUAGA -26.91
ahy-miRn14 11 UUAAUUUCUGAGUUUGUCAUC -32.57
ahy-miRn14* 1 UUGAUAAGAUAGAAAUUGUAU -32.57