Skip to main content

Advertisement

Table 1 Conserved miRNAs from peanut

From: Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaeaL.)

miRNA family Name Sequence(5'-3') Length (nt) Reference miRNA Conserved in other plants Reads
      ath ptc vvi osa  
156/157 ahy-MIR156a ugacagaagagagugagcac 20 ath-miR156a ++ ++ ++ ++ 17058
  ahy-MIR156b ugacagaagagagugagcaca 21 bna-miR156a + + + + 255
  ahy-MIR156c cugacagaagauagagagcac 21 smo-miR156b + + + + 43
  ahy-MIR156e ugacagaggagagugagcac 20 vvi-miR156e + + ++ + 8
  ahy-MIR156 g cgacagaagagagugagcac 20 ath-miR156 g ++ + + + 15
  ahy-MIR156 h ugacagaagaaagagagcac 20 ath-miR156 h ++ + + + 4
  ahy-MIR156k ugacagaagagagggagcac 20 ptc-miR156k + ++ ++ + 69
  ahy-MIR156f uugacagaagaaagagagcac 21 smo-MIR156c + + + + 4
  ahy-MIR157a uugacagaagauagagagcac 21 ath-miR157a ++ ++ ++ + 95381
  ahy-MIR157d ugacagaagauagagagcac 20 ath-miR157d ++ + ++ + 3967
  ahy-MIR157k ugacagaagagagcgagcac 20 zma-miR156k + + + + 67
159 ahy-MIR159a uuuggauugaagggagcucua 21 ath-miR159a ++ ++ ++ + 66
  ahy-MIR159b uuuggauugaagggagcucuu 21 ath-miR159b ++ + + + 41
  ahy-MIR319a uuggacugaagggagcucccu 21 ath-miR319a ++ + + + 12
  ahy-MIR319b uuggacugaagggagcuccc 20 mtr-miR319 + ++ + + 5
160 ahy-MIR160a ugccuggcucccuguaugcca 21 ath-miR160a ++ ++ ++ ++ 41
  ahy-MIR160b ugccuggcucccugaaugcca 21 osa-miR160f + ++ ++ ++ 4
162 ahy-MIR162a ucgauaaaccucugcauccag 21 ath-miR162a ++ ++ ++ ++ 94
164 ahy-MIR164a uggagaagcagggcacgugca 21 ath-miR164a ++ ++ ++ ++ 4116
  ahy-MIR164d uggagaagcagggcacgugcu 21 osa-miR164d + + + ++ 88
  ahy-MIR164c uggagaagcagggcacgugcg 21 ath-miR164c ++ + + + 4
  ahy-MIR164d uggagaagcaggguacgugca 21 osa-miR164c + + + ++ 1
166 ahy-MIR165a ucggaccaggcuucauccccc 21 ath-miR165a ++ + + + 40
  ahy-MIR166a ucggaccaggcuucauucccc 21 ath-miR166a ++ ++ ++ ++ 9577
  ahy-MIR166d ucggaccaggcuucauuccccu 22 vvi-miR166d + + ++ + 9
  ahy-MIR166 g ucggaccaggcuucauuccuc 21 osa-miR166 g + + ++ ++ 3647
  ahy-MIR166 h ucggaccaggcuucauuccc 20 zma-miR166 h + + + + 8585
  ahy-MIR166j ucggaucaggcuucauuccuc 21 osa-miR166j + + + ++ 8
  ahy-MIR166 m ucggaccaggcuucauucccu 21 osa-miR166 m + + + ++ 35
  ahy-MIR166n ucggaccaggcuucauuccuu 21 ptc-miR166n + ++ + + 13
  ahy-MIR166e ucgaaccaggcuucauucccc 21 osa-MIR166e + + + ++ 3
  ahy-MIR166k ucggaccaggcuucaaucccu 21 osa-miR166k + + + ++ 1
  ahy-MIR166b ucggaccaggcuucauuccccc 22 vvi-miR166c + + ++ + 5
167 ahy-MIR167a ugaagcugccagcaugaucua 21 ath-miR167a ++ ++ ++ ++ 2572
  ahy-MIR167b ugaagcugccagcaugaucuaa 22 bna-miR167a + + + + 34
  ahy-MIR167c ugaagcugccagcaugaucuc 21 vvi-miR167c + + ++ + 15
  ahy-MIR167d ugaagcugccagcaugaucugg 22 ath-miR167d + + + + 224
  ahy-MIR167e ugaagcugccagcaugaucug 21 osa-miR167d + ++ ++ + 34
  ahy-MIR167f ugaagcugccagcaugaucuu 21 ptc-miR167f + ++ + + 8767
168 ahy-MIR168a ucgcuuggugcaggucgggaa 21 ath-miR168a ++ ++ ++ + 19898
  ahy-MIR168b ucgcuuggugcagaucgggac 21 osa-miR168a + + + ++ 86
169 ahy-MIR169b cagccaaggaugacuugccgg 21 ath-miR169b ++ ++ ++ ++ 66
  ahy-MIR169e uagccaaggaugacuugccgg 21 osa-miR169e + + + ++ 1
  ahy-MIR169a cagccaaggaugacuugccga 21 ath-miR169a ++ ++ ++ ++ 1
  ahy-MIR169 m gagccaaggaugacuugccgg 21 vvi-miR169 m + + ++ + 1
171 ahy-MIR171b ugauugagccgugccaauauc 21 osa-miR171b + ++ + ++ 26
  ahy-MIR171c agauugagccgcgccaauauc 21 ptc-miR171c + ++ + + 1
  ahy-MIR171d ugauugagccgcgucaauauc 21 vvi-miR171b + + ++ + 5
  ahy-MIR171f uugagccgcgccaauaucacu 21 vvi-miR171f + + ++ + 3
  ahy-MIR171e uugagccgugccaauaucac 20 zma-miR171b + + + + 1
  ahy-MIR171a uugagccgugccaauaucaca 21 zma-miR171f + + + + 4
172 ahy-MIR172a agaaucuugaugaugcugcau 21 ath-miR172a ++ ++ ++ ++ 2176
  ahy-MIR172b agaaucuugaugaugcugca 20 zma-miR172a + + + + 81
  ahy-MIR172c agaaucuugaugaugcugcag 21 ath-miR172c ++ + + + 58
  ahy-MIR172e ggaaucuugaugaugcugcau 21 ath-miR172e ++ ++ + ++ 2
390 ahy-MIR390a aagcucaggagggauagcgcc 21 ath-miR390a ++ ++ ++ ++ 149
393 ahy-MIR393a uccaaagggaucgcauugaucc 22 ath-miR393a ++ + ++ + 2
  ahy-MIR393b uccaaagggaucgcauugauc 21 osa-miR393 + ++ + ++ 6
  ahy-MIR393c uccaaagggaucgcauugaucu 22 osa-miR393b + + + ++ 1
394 ahy-MIR394a uuggcauucuguccaccucc 20 ath-miR394a ++ ++ ++ ++ 8
396 ahy-MIR396a uuccacagcuuucuugaacug 21 ath-miR396a ++ ++ ++ ++ 221
  ahy-MIR396b uuccacagcuuucuugaacuu 21 ath-miR396b ++ ++ + ++ 35
  ahy-MIR396d uccacaggcuuucuugaacug 21 osa-miR396d + + + ++ 1
  ahy-MIR396c uuccacagcuuucuugaacua 21 vvi-miR396a + + ++ + 5
  ahy-MIR396e uuccacagcuuucuugaacu 20 vvi-miR396b + + ++ + 2
397 ahy-MIR397a ucauugagugcagcguugaug 21 ath-miR397a ++ ++ ++ ++ 344
  ahy-MIR397c ucauugagugcagcguugaugu 22 bna-miR397a + + + + 5
  ahy-MIR397b uuauugagugcagcguugaug 21 osa-miR397b + + + ++ 1
398 ahy-MIR398b uguguucucaggucgccccug 21 osa-miR398b + ++ ++ ++ 12
399 ahy-MIR399e ugccaaaggagauuugcccag 21 osa-miR399e + + + ++ 1
408 ahy-MIR408a augcacugccucuucccuggc 21 ath-miR408 ++ ++ ++ + 105
  ahy-MIR408b ugcacugccucuucccuggcu 21 ppt-miR408b + + + + 5
528 ahy-MIR528 uggaaggggcaugcagaggag 21 osa-miR528     ++ 3
535 ahy-MIR535 ugacaacgagagagagcacgc 21 ppt-miR535a    + + 1
894 ahy-MIR894 cguuucacgucggguucacc 20 ppt-miR894      2
  1. The abbreviations represent: ath, Arabidopsis thaliana; ptc, Populus trichocarpa; vvi, Vitis vinifera; osa, Oryza sativa. The plus symbols indicate: ++, miRNA sequences of peanut were exactly identical to those in other species; +, miRNA sequences of peanut were conserved in other species but have variations in some nucleotide positions.