Skip to main content

Advertisement

Table 4 Primers used for real time RT-PCR of differentially expressed peanut seed proteins in different treatments

From: Identification of seed proteins associated with resistance to pre-harvested aflatoxin contamination in peanut (Arachis hypogaea L)

Spot NO. Protein description forward primer(5'-3') reverse primer(5'-3') Length (bp)
S6107 Low molecular weight HSP precursor GCTGGACTTCGTCGTGGTTG TGGTCAGGGTGTTCTGCTCC 121
S6256 Os07g0179400 CCGCTCAAGATGATCCCATG ACTGTGCTGAAGCGGTGAGG 129
S6258 PII protein ATCGGAACGTGGTTCTCACG GCCTAAGAATGGCTTCCGCT 132
S6264 CDKD1 GTGCTTCAGCGATTCAACGA GAGGGATCCGGGTCTGTCAT 131
S6278 Oxalate Oxidase GTTCCATTGTAACAGGAGCCA TGAGTCCACCTGGGGCATA 123
S6503 SAP domain-containing protein CACCAGAGGGCCAGCATATT GATCCCTCGGTTCCATCCTT 115
S1314 Trypsin inhibitor AAAATGCGTGCCAGTTCCAG GGAGGACTAAGCGCGAGAGG 141
S1368 RIO kinase TGGCTTGACTCCAAGGACGA GAGAGAGGCTGGAGGGTGGA 125
S1419 Iso-Ara h3 TCCAATGCTCCCCTCGAGAT TGGGTCGTCCTGCCCTACTT 159
S1429 50 S ribosomal protein L22 TCTCTCTCAATTCTCGCCGC CACGAATGTGGTGCGTGAAC 117
S1521 L-ascorbate peroxidase 1 TGGCCGGTGTAGTTGCTGTT CCCATAGCCTTGCCAAACAC 154
S6169 Putative 30 S ribosomal protein S9 AGGAGGCGGTGTTTCAGGTC TGTCAGGAAGCCAGCGTTTC 112