Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Overexpression of PtrABF gene, a bZIP transcription factor isolated from Poncirus trifoliata, enhances dehydration and drought tolerance in tobacco via scavenging ROS and modulating expression of stress-responsive genes

Genes Primers Annealing temperature (°C) Product size (bp) Sequences (5'-3')  
     Forward Reverse Used for
PtrABF GSP1 60 1511 ATTGGAGCAAGCTGTTGCCACCGC CGCAGCTGCCTACACTCCATGG Amplification of full-length cDNA
Actin Actin 58 107 ATTGTAAGCAACTGGGATGATA AGAGGTGCCTCAGTGAGAAG Quantitative real-time PCR
PtrABF GSP2 57 113 CCATCACCAGTTCCTTATGTGTT GATCTTGCAGCTGACTCTCTGTT  
PtrABF GSP3 58 1363 GGCTCGAGATGGGATCTCAAATGAACTTCAAG (XhoI site is underlined) AAGGATCCCGTCAGTGTCCTCCTCAAGCACAG (BamHI site is underlined) Subcellular localization
GFP GFP-GSP1 60 732 CGGGATCCATGAGTAAAGGAGAAG (BamHI site is underlined) CGGTACCTTATTTGTATAGTTCATCC (KpnI site is underlined)  
PtrABF GSP4 60 1366 GGCCATGGCGATGGGATCTCAAATGAACTTCAAG (NcoI site is underlined) ATAGGATCCCTACCAAGGGCCCGTCAGTGTCC (BamHI site is underlined) Transcriptional activation assay
PtrABF GSP5 58 160 ATTGGAGCAAGCTGTTGCCACCGC CGCAGCTGCCTACACTCCATGG Transgene overexpression
CaMV35S-PtrABF 35S-PtrABF 60 2013 CGCCGTAAAGACTGGCGAACAGTTCATACAGAGT CGCAGCTGCCTACACTCCATGG Confirmation of transgenic plants
NPTII NPTII 56 742 AGACAATCGGCTGCTCTGAT TCATTTCGAACCCCAGAGTC  
NtADC1   58 306 CTTGCTGATTACCGCAATTTATC CCTTACTGCAGGCTTTTCATCTA Analysis of expression levels
NtADC2   58 350 GCCGGCCCTAGGTTGTTGTGTAGATG AGCGAACAACAAGAGGCAGCTGAAGCC  
NtAREB   58 224 TCTTCACAGCAAAAGCCTCA GTGACCCCATTATGCAATCC  
NtCAT   58 151 AGGTACCGCTCATTCACACC AAGCAAGCTTTTGACCCAGA  
NtCDPK2   58 267 AGGTGAGCTTTTCGATAGGATTATT ACTTCTGGTGCAACATAGTAAGGAC  
NtDREB   58 503 GGACCCACTTGCTGATTCTT GCGCCTCCTCATCCATATAA  
NtERD10C   58 366 ACGTGGAGGCTACAGATCGTGGTTTG TCTCCACTGGTACAGCCGTGTCCTCAC  
NtERF   58 220 ACACTTCATTTTCACATTCCAACTT TCTTCTAATTCTTGACCATGGCTAC  
NtLEA5   58 350 TTGTTAGCAGGCGTGGGTAT CTCTCGCTCTTGTTGGGTTC  
NtAPX   58 262 CAAATGTAAGAGGAAACTCAGAGGA AGCAACAACTCCAGCTAATTGATAG  
NtSAMDC   58 313 ATTGGTTTTGAAGGTTTTGAGAAG TCACGTCTTGTACTTTGAGAGACAG  
NtSOD   58 238 AGCTACATGACGCCATTTCC CCCTGTAAAGCAGCACCTTC  
Tubulin   58 163 TCCAGGACAAGGAGGGTAT CATCAACAACAGGCAACCTAG