Skip to main content

Table 4 Microsatellite markers used to screen for heterozygosity on the maternal parent (palm BL013/12-06) of DH candidate palm (0644-219/05049582C).

From: Production of haploids and doubled haploids in oil palm

No Marker Forward Primer (5'-3') Reverse Primer (5'-3')
1 VS1 GAGATTACAAAGTCCAAACC TCAAAATTAAGAAAGTATGC
2 OPSSR 3 ACGCATGCAGCTAGCTTTTC CGCGTGAAAGATATGAATCAAC
3 OPSSR 7 CACGCACGCAGTTTATTCTT GGATGTATGCTTTACCTCCGAAT
4 OPSSR 8 CCCCTTTTGCTTCCCTATTT CTCCTTTTCCCCATCACAGA
5 OPSSR 9 GACACAAGCAAAAACAAAAGCA ATTCTGAAAGGAGGGGGAAA
6 OPSSR 14 ATATGTGTGGGTGTGCGTGT TGCCTCTGGTTGTTAGTCTGG
7 OPSSR 19 TCTCTCTCTCTCTCTCTATGTGTGTGT TGGCAATCAGCACACATTCT
8 OPSSR 29 GCAGCTCTTTCCACACCTCT TGTGGTCTCCTGAGGAAGATG
9 OPSSR 30 TTTTCCCCATCACAGAATTG CCCCTTTTGCTTCCCTATTT
10 OPSSR32 GAACAAAACGGGAAGAAGCA CCTCAAATGGGAGAAACCAG
11 mEgUWA07 CGGATAGAGGCAGCAAGACT CTCGGGTTGTTTAACCCATT
12 mEgUWA44 TTGAGACGTCGTTCCTTTCC AGCGGAGACCCAATAATCCT
13 mEgUWA50 CCTGCAACTGCAAATGAGAC TCCAGACACAAACTACACACACC
14 mEgCIR0037 Published by Billotte et al. [27]
15 mEgCIR0055 Published by Billotte et al. [27]
16 mEgCIR0059 Published by Billotte et al. [27]
17 mEgCIR0067 Published by Billotte et al. [28]
18 mEgCIR0074 Published by Billotte et al. [27]
19 mEgCIR0146 Published by Billotte et al. [27]
20 mEgCIR0163 Published by Billotte et al. [27]
21 mEgCIR0173 Published by Billotte et al. [27]
22 mEgCIR0177 Published by Billotte et al. [27]
23 mEgCIR0192 Published by Billotte et al. [27]
24 mEgCIR0195 Published by Billotte et al. [27]
25 mEgCIR0243 Published by Billotte et al. [27]
26 mEgCIR0246 Published by Billotte et al. [27]
27 mEgCIR0257 Published by Billotte et al. [27]
28 mEgCIR0268 Published by Billotte et al. [27]
29 mEgCIR0328 Published by Billotte et al. [27]
30 mEgCIR0359 Published by Billotte et al. [27]
31 mEgCIR0366 Published by Billotte et al. [27]
32 mEgCIR0369 Published by Billotte et al. [27]
33 mEgCIR0380 Published by Billotte et al. [27]
34 mEgCIR0399 Published by Billotte et al. [27]
35 mEgCIR0408 Published by Billotte et al. [27]
36 mEgCIR0409 Published by Billotte et al. [27]
37 mEgCIR0425 Published by Billotte et al. [27]
38 mEgCIR0433 Published by Billotte et al. [27]
39 mEgCIR0439 Published by Billotte et al. [27]
40 mEgCIR0445 Published by Billotte et al. [27]
41 mEgCIR0446 Published by Billotte et al. [27]
42 mEgCIR0465 Published by Billotte et al. [27]
43 mEgCIR0521 Published by Billotte et al. [27]
44 mEgCIR0551 Published by Billotte et al. [27]
45 mEgCIR0555 Published by Billotte et al. [27]
46 mEgCIR0588 Published by Billotte et al. [27]
47 mEgCIR0772 Published by Billotte et al. [27]
48 mEgCIR0773 Published by Billotte et al. [27]
49 mEgCIR0774 Published by Billotte et al. [27]
50 mEgCIR0775 Published by Billotte et al. [27]
51 mEgCIR0778 Published by Billotte et al. [27]
52 mEgCIR0779 Published by Billotte et al. [27]
53 mEgCIR0781 Published by Billotte et al. [27]
54 mEgCIR0786 Published by Billotte et al. [27]
55 mEgCIR0787 Published by Billotte et al. [27]
56 mEgCIR0788 Published by Billotte et al. [27]
57 mEgCIR0790 Published by Billotte et al. [27]
58 mEgCIR0793 Published by Billotte et al. [27]
59 mEgCIR0800 Published by Billotte et al. [27]
60 mEgCIR0801 Published by Billotte et al. [27]
61 mEgCIR0802 Published by Billotte et al. [27]
62 mEgCIR0803 Published by Billotte et al. [27]
63 mEgCIR0804 Published by Billotte et al. [27]
64 mEgCIR0825 Published by Billotte et al. [27]
65 mEgCIR0827 Published by Billotte et al. [27]
66 mEgCIR0844 Published by Billotte et al. [27]
67 mEgCIR0874 Published by Billotte et al. [27]
68 mEgCIR0878 Published by Billotte et al. [27]
69 mEgCIR0882 Published by Billotte et al. [27]
70 mEgCIR0886 Published by Billotte et al. [27]
71 mEgCIR0894 Published by Billotte et al. [27]
72 mEgCIR0905 Published by Billotte et al. [27]
73 mEgCIR0906 Published by Billotte et al. [27]
74 mEgCIR0910 Published by Billotte et al. [27]
75 mEgCIR0912 Published by Billotte et al. [27]
76 mEgCIR1729 Published by Billotte et al. [27]
77 mEgCIR1740 Published by Billotte et al. [27]
78 mEgCIR1753 Published by Billotte et al. [27]
79 mEgCIR1773 Published by Billotte et al. [27]
80 mEgCIR1917 Published by Billotte et al. [27]
81 mEgCIR1977 Published by Billotte et al. [27]
82 mEgCIR1996 Published by Billotte et al. [27]
83 mEgCIR2110 Published by Billotte et al. [27]
84 mEgCIR2144 Published by Billotte et al. [27]
85 mEgCIR2149 Published by Billotte et al. [27]
86 mEgCIR2188 Published by Billotte et al. [27]
87 mEgCIR2212 Published by Billotte et al. [27]
88 mEgCIR2215 Published by Billotte et al. [27]
89 mEgCIR2380 Published by Billotte et al. [27]
90 mEgCIR2387 Published by Billotte et al. [27]
91 mEgCIR2414 Published by Billotte et al. [27]
92 mEgCIR2417 Published by Billotte et al. [27]
93 mEgCIR2422 Published by Billotte et al. [27]
94 mEgCIR2423 Published by Billotte et al. [27]
95 mEgCIR2427 Published by Billotte et al. [27]
96 mEgCIR2436 Published by Billotte et al. [27]
97 mEgCIR2440 Published by Billotte et al. [27]
98 mEgCIR2492 Published by Billotte et al. [27]
99 mEgCIR2518 Published by Billotte et al. [27]
100 mEgCIR2525 Published by Billotte et al. [27]
101 mEgCIR2569 Published by Billotte et al. [27]
102 mEgCIR2575 Published by Billotte et al. [27]
103 mEgCIR2577 Published by Billotte et al. [27]
104 mEgCIR2590 Published by Billotte et al. [27]
105 mEgCIR2595 Published by Billotte et al. [27]
106 mEgCIR2600 Published by Billotte et al. [27]
107 mEgCIR2621 Published by Billotte et al. [27]
108 mEgCIR2628 Published by Billotte et al. [27]
109 mEgCIR2763 Published by Billotte et al. [27]
110 mEgCIR2813 Published by Billotte et al. [27]
111 mEgCIR2860 Published by Billotte et al. [27]
112 mEgCIR2887 Published by Billotte et al. [27]
113 mEgCIR2893 Published by Billotte et al. [27]
114 mEgCIR3040 Published by Billotte et al. [27]
115 mEgCIR3111 Published by Billotte et al. [27]
116 mEgCIR3160 Published by Billotte et al. [27]
117 mEgCIR3194 Published by Billotte et al. [27]
118 mEgCIR3213 Published by Billotte et al. [27]
119 mEgCIR3232 Published by Billotte et al. [27]
120 mEgCIR3295 Published by Billotte et al. [27]
121 mEgCIR3296 Published by Billotte et al. [27]
122 mEgCIR3297 Published by Billotte et al. [27]
123 mEgCIR3298 Published by Billotte et al. [27]
124 mEgCIR3300 Published by Billotte et al. [27]
125 mEgCIR3301 Published by Billotte et al. [27]
126 mEgCIR3305 Published by Billotte et al. [27]
127 mEgCIR3307 Published by Billotte et al. [27]
128 mEgCIR3310 Published by Billotte et al. [27]
129 mEgCIR3311 Published by Billotte et al. [27]
130 mEgCIR3316 Published by Billotte et al. [27]
131 mEgCIR3321 Published by Billotte et al. [27]
132 mEgCIR3328 Published by Billotte et al. [27]
133 mEgCIR3350 Published by Billotte et al. [27]
134 mEgCIR3384 Published by Billotte et al. [27]
135 mEgCIR3389 Published by Billotte et al. [27]
136 mEgCIR3399 Published by Billotte et al. [27]
137 mEgCIR3400 Published by Billotte et al. [27]
138 mEgCIR3402 Published by Billotte et al. [27]
139 mEgCIR3427 Published by Billotte et al. [27]
140 mEgCIR3428 Published by Billotte et al. [27]
141 mEgCIR3433 Published by Billotte et al. [27]
142 mEgCIR3439 Published by Billotte et al. [27]
143 mEgCIR3477 Published by Billotte et al. [27]
144 mEgCIR3519 Published by Billotte et al. [27]
145 mEgCIR3526 Published by Billotte et al. [27]
146 mEgCIR3533 Published by Billotte et al. [27]
147 mEgCIR3534 Published by Billotte et al. [27]
148 mEgCIR3535 Published by Billotte et al. [27]
149 mEgCIR3538 Published by Billotte et al. [27]
150 mEgCIR3543 Published by Billotte et al. [27]
151 mEgCIR3544 Published by Billotte et al. [27]
152 mEgCIR3546 Published by Billotte et al. [27]
153 mEgCIR3555 Published by Billotte et al. [27]
154 mEgCIR3557 Published by Billotte et al. [27]
155 mEgCIR3563 Published by Billotte et al. [27]
156 mEgCIR3567 Published by Billotte et al. [27]
157 mEgCIR3569 Published by Billotte et al. [27]
158 mEgCIR3574 Published by Billotte et al. [27]
159 mEgCIR3587 Published by Billotte et al. [27]
160 mEgCIR3590 Published by Billotte et al. [27]
161 mEgCIR3592 Published by Billotte et al. [27]
162 mEgCIR3593 Published by Billotte et al. [27]
163 mEgCIR3607 Published by Billotte et al. [27]
164 mEgCIR3622 Published by Billotte et al. [27]
165 mEgCIR3633 Published by Billotte et al. [27]
166 mEgCIR3639 Published by Billotte et al. [27]
167 mEgCIR3643 Published by Billotte et al. [27]
168 mEgCIR3649 Published by Billotte et al. [27]
169 mEgCIR3653 Published by Billotte et al. [27]
170 mEgCIR3655 Published by Billotte et al. [27]
171 mEgCIR3663 Published by Billotte et al. [27]
172 mEgCIR3668 Published by Billotte et al. [27]
173 mEgCIR3672 Published by Billotte et al. [27]
174 mEgCIR3683 Published by Billotte et al. [27]
175 mEgCIR3684 Published by Billotte et al. [27]
176 mEgCIR3691 Published by Billotte et al. [27]
177 mEgCIR3693 Published by Billotte et al. [27]
178 mEgCIR3696 Published by Billotte et al. [27]
179 mEgCIR3698 Published by Billotte et al. [27]
180 mEgCIR3705 Published by Billotte et al. [27]
181 mEgCIR3711 Published by Billotte et al. [27]
182 mEgCIR3716 Published by Billotte et al. [27]
183 mEgCIR3718 Published by Billotte et al. [27]
184 mEgCIR3722 Published by Billotte et al. [27]
185 mEgCIR3727 Published by Billotte et al. [27]
186 mEgCIR3728 Published by Billotte et al. [27]
187 mEgCIR3732 Published by Billotte et al. [27]
188 mEgCIR3737 Published by Billotte et al. [27]
189 mEgCIR3739 Published by Billotte et al. [27]
190 mEgCIR3745 Published by Billotte et al. [27]
191 mEgCIR3747 Published by Billotte et al. [27]
192 mEgCIR3750 Published by Billotte et al. [27]
193 mEgCIR3755 Published by Billotte et al. [27]
194 mEgCIR3766 Published by Billotte et al. [27]
195 mEgCIR3769 Published by Billotte et al. [27]
196 mEgCIR3775 Published by Billotte et al. [27]
197 mEgCIR3782 Published by Billotte et al. [27]
198 mEgCIR3785 Published by Billotte et al. [27]
199 mEgCIR3787 Published by Billotte et al. [27]
200 mEgCIR3788 Published by Billotte et al. [27]
201 mEgCIR3792 Published by Billotte et al. [27]
202 mEgCIR3807 Published by Billotte et al. [27]
203 mEgCIR3808 Published by Billotte et al. [27]
204 mEgCIR3809 Published by Billotte et al. [27]
205 mEgCIR3813 Published by Billotte et al. [27]
206 mEgCIR3819 Published by Billotte et al. [27]
207 mEgCIR3825 Published by Billotte et al. [27]
208 mEgCIR3826 Published by Billotte et al. [27]
209 mEgCIR3828 Published by Billotte et al. [27]
210 mEgCIR3847 Published by Billotte et al. [27]
211 mEgCIR3850 Published by Billotte et al. [27]
212 mEgCIR3869 Published by Billotte et al. [27]