Skip to main content

Table 3 Microsatellite markers (described by Billotte et al. [27]) used for a larger-scale survey for hemizygosity of Hs and homozygosity of DH candidates previously identified by the morphological screen, microsatellite pre-screen (15 markers) and flow cytometry screen.

From: Production of haploids and doubled haploids in oil palm

No. Forward primer (5'-3') Reverse primer (5'-3')
16 GACCTTTGTCAGCATACTTGGTGTG GCAGGCCTGAAATCCCAAAT
17 ATGCATGTGATTTTATTAGGTGAGA CGACCCTCAGTCAATCAGTAAG
18 AAGCTAGCGACCTATGATTTTAGA AAACAAGTAATGTGCATAACCTTTC
19 CCCACCACCCCTAGCTTCTC ACCCCGGTCCAAATAAAATC
20 AGAGAGAGAGAGTGCGTATG GTCCCTGTGGCTGCTGTTTC
21 GGGTAGCAAACCTTGTATTA ACTTCCATTGTCTCATTATTCT
22 CGAGGCCCAAAAACATTCAC GGTCCCGATCCCGTCTACTG
23 TTGCGGCCCATCGTAATC TCCCTGCAGTGTCCCTCTTT
24 AGGGAATTGGAAGAAAAGAAAG TCCTGAGCTGGGGTGGTC
25 AGCAAGAGCAAGAGCAGAACT CTTGGGGGCTTCGCTATC
26 TAGCCATGCCGCCACCACTT CAATCCATTAGCGTGCCCTTCT
27 CTTACCCCGCCTCCTCTCCT CGAAATGCCCTTCCTTTACACTA
28 CCTTATATCGCACGGGTTCC TTCTTGGGGTCTCGCTACGG
29 GCAAGATGCAATGGAGTTCA CAAACCGCAGCAAGTCAGA
30 GCAAAATTCAAAGAAAACTTA CTGACAGTGCAGAAAATGTTATAGT
31 CGTTCATCCCACCACCTTTC GCTGCGAGGCCACTGATAC
32 GAATGTGGCTGTAAATGCTGAGTG AAGCCGCATGGACAACTCTAGTAA
33 ACATTCCCTCTATTATTCTCAC GTTTTGTTTGGTATGCTTGT
34 AAGCCAACTTCACAGATATGTTGAT ATGAGCCTAACAAAGCACATTCTAA
35 AGTGAGGTATGGTTGATTAGGA TATTGATAGCATTTGGGATTAG
36 CTCCGATGGTCAAGTCAGA AAATGGGGAAGGCAATAGTG
37 GCCGTTCAAGTCAATTAGAC TTTGGGAGCAAGCATTATCA
38 TGCTTCTTGTCCTTGATACA CCACGTCTACGAAATGATAA
39 CACCACATGAAGCAAGCAGT CCTACCACAACCCCAGTCTC
40 TTTTATTTTCCCTCTCTTTTGA ATTGCGTCTCTTTCCATTGA
41 CATATGGCGCACAGGCAC GCAATACAAGAGCACCCAAAT
42 AGTTGGTTTGCTGATTTG TGTTGCTTCTTTGATTTTC
43 GCTGAAGATGAAATTGATGTA TTCAGGTCCACTTTCATTTA
44 ATGACCTAAAAATAAAATCTCAT ACAGATCATGCTTGCTCACA
45 GGTGCAAGAGAGGAGGAATG TTTGGTAGTCGGGCGTTTTA
46 GTTTGGCTTTGGACATG TCCATCACAGGAGGTATAG
47 TGTTTTGTTTCGTGCATGTG GGCTGACATGCAACACTAAC
48 CGGTTTTGTCGCATCTATG GTCGTCAGGGAACAACAGT
49 CAATCATTGGCGAGAGA CGTCACCTTTCAGGATATG
50 GAGCATGACGCAAACAAAGG GCAACATGTTTGATGCATTAATAGTC
51 TCCAAGTAGCAAATGATGAC TGCCCTGAAACCCTTGA
52 GAAGGGGCATTGGATTT TACCTATTACAGCGAGAGTG
53 AACACTCCAGAAGCCAGGTC GGTTTAGGTATTGGAACTGATAGAC
54 GATCCCAATGGTAAAGACT AAGCCTCAAAAGAAGACC
55 TGTGGTTTGAGGCATCTTCT GCCCACCAAAAGAAAGTAGT
56 TAGCCGCACTCCCACGAAGC CCAGAATCATCAGACTCGGACAG
57 TCAAAGAGCCGCACAACAAG ACTTTGCTGCTTGGTGACTTA
58 GGGGATGAGTTTGTTTGTTC CCTGCTTGGCGAGATGA
59 TCTAATGCTCCCAAGGTACA GGCTTGGTCCACGATCTT
60 AGCTCTCATGCAAGTAAC TTCAACATACCGTCTGTA
61 TCCTCACTGCTCCTCTAATC ACTCCCTATGGACCTTAGTC
62 AGGGAGGCGAACGAGAAACA CGACTGCTGATGGGGAAGAG
63 CTACGGACTCACACCTATAT ATGGTTCATCAATGAGATC
64 GTGAGCGATTGAGGGGTGTG GGGGCTTGATTGAGTATTTCCA
65 AGGGCAAGTCATGTTTC TATAAGGGCGAGGTATT
66 GAAGCCTGAGACCGCATAGA TTCGGTGATGAAGATTGAAG
67 TTTCTTATGGCAATCACACG GGAGGGCAGGAACAAAAAGT
68 GTTTATCATTTTGGGGTCAG CGGTGTCCCTCAGGATGTA
69 CATGCACGTAAAGAAAGTGT CCAAATGCACCCTAAGA
70 AATCCAAGTGGCCTACAG CATGGCTTTGCTCAGTCA
71 TGTAGGTGGTGGTTAGG TGTCAGACCCACCATTA
72 AGCAAGACACCATGTAGTC GACACGTGGGATCTAGAC
73 AAAAGCCGATAGTGGGAACA ATGCTGAGAGGTGGAAAATAGAG
74 GTCCATGTGCATAAGAGAG CTCTTGGCATTTCAGATAC
75 AGCCAATGAAGGATAAAGG CAAGCTAAAACCCCTAATC
76 CAATTCCAGCGTCACTATAG AGTGGCAGTGGAAAAACAGT
77 GGGCTTTCATTTTCCACTAT GCTCAACCTCATCCACAC
78 GACAGCTCGTGATGTAGA GTTCTTGGCCGCTATAT
79 ACTTGTAAACCCTCTTCTCA GTTTCATTACTTGGCTTCTG
80 CCTTCAAGCAAAGATACC GGCACCAAACACAGTAA
81 CCACTGCTTCAAATTTACTAG GCGTCCAAAACATAAATCAC
82 GGGAGAGGAAAAAATAGAG CCTCCCTGAGACTGAGAAG
83 AGCAGGGCAAGAGCAATACT TTCAGCAGCAGGAAACATC
84 GCCTATCCCCTGAACTATCT TGCACATACCAGCAACAGAG
85 CATCAGAGCCTTCAAACTAC AGCCTGAATTGCCTCTC
86 ATTCATTGCCATTCCCTTCA TTGTCCCCTCTGTTCACTCA
87 ATTGCAGAGATGATGAGAAG GAGATGCTGACAATGGTAGA
88 TCTCCCAAATCACTAGAC ATCTGCAAGGCATATTC
89 ACGTTTTGGCAACTCTC ACTCCCCTCTTTGACAT
90 TCCACTCTGGCAACTCC AAGGATGGGCTTTGTAGT
91 TTTAGAGGACAAGGAGATAAG CGACCGTGTCAAGAGTG
92 AGCAAAATGGCAAAGGAGAG GGTGTGTGCTATGGAAGATCATAGT
93 GTAGCTTGAACCTGAAA AGAACCACCGGAGTTAC
94 AAGCCACCAGGATCATC GTCATTGCCACCTCTAACT
95 TTACTTGCTAAGCTCTCTAGC TGGCTGTTTAATCTGTCTG
96 TCTATATTTGGTTGGCTTGA ACTCATTTCAATCTCAGTGTC
97 TGCTACGTGCTGAAATA ATTTCAGGTTCGCTTCA
98 CCTCCACTTCTCTTCATCTT CTTCCTCAAGCTCAAACAAT
99 GATGTTGCCGCTGTTTG CATCCCATTTCCCTCTT
100 ATGCTCCACCAAGTTTA CACATCCTAGCATCATTG
101 AAGCAATATAGGTTCAGTTC TCATTTTCTAATTCCAAACAAG
102 GCTCGTTTTTGTTTAGGTGA TTTTCTCCATAGTCCGTTAC
103 CAGCACACAAATGACAT CACCTTTCCTTTTTGTC
104 CCTATTCCTTACCTTTCTGT GACTTACTATCTTGGCTCAC
105 CCTTGCATTCCACTATT AGTTCTCAAGCCTCACA
106 CCTCCTTTGGAATTATG GTGTTTGATGGGACATACA
107 ATTGGAGAGCACTTGGATAG TTCTCTTCCTTCTCACTTGT
108 AGCCAGATGGAAATACAC GTGCGATAAAGAGGAGAGT
109 TAGTTTTCCCATCACAGAGT ACAATATTTAGACCTTCCATGAG
110 GTGCAGATGCAGATTATATG CCTTTAGAATTGCCGTATC
111 ACAATAACCTGAGACAACAAGAAAC ATACATCCCCTCCCCTCTCT
112 GAACTTGGCGTGTAACT TGGTAGGTCTATTTGAGAGT