Skip to main content

Table 1 Microsatellite primer pairs used to identify homozygous DH or hemizygous H candidates in the initial molecular screen.

From: Production of haploids and doubled haploids in oil palm

No. Forward primer (5'-3') Reverse primer (5'-3')
1 GAGATTACAAAGTCCAAACC TCAAAATTAAGAAAGTATGC
2 ACGCATGCAGCTAGCTTTTC CGCGTGAAAGATATGAATCAAC
3 CACGCACGCAGTTTATTCTT GGATGTATGCTTTACCTCCGAAT
4 CCCCTTTTGCTTCCCTATTT CTCCTTTTCCCCATCACAGA
5 GACACAAGCAAAAACAAAAGCA ATTCTGAAAGGAGGGGGAAA
6 ATATGTGTGGGTGTGCGTGT TGCCTCTGGTTGTTAGTCTGG
7 TCTCTCTCTCTCTCTCTATGTGTGTGT TGGCAATCAGCACACATTCT
8 GCAGCTCTTTCCACACCTCT TGTGGTCTCCTGAGGAAGATG
9 TTTTCCCCATCACAGAATTG CCCCTTTTGCTTCCCTATTT
10 TAGCCGCACTCCCACGAAGC CCAGAATCATCAGACTCGGACAG
11 AGCTCTCATGCAAGTAAC TTCAACATACCGTCTGTA
12 CCTTCAAGCAAAGATACC GGCACCAAACACAGTAA
13 GTAGCTTGAACCTGAAA AGAACCACCGGAGTTAC
14 GCTCGTTTTTGTTTAGGTGA TTTTCTCCATAGTCCGTTAC
15 CCTCGGGTTATCCTTTTTACC TGGCTGGCTTCGGTCTTAG
  1. Markers 10-15 obtained from Billotte et al. [27].