Skip to main content

Table 2 Primers used in this study

From: Characterization, sub-cellular localization and expression profiling of the isoprenylcysteine methylesterase gene family in Arabidopsis thaliana

Name Sequence (5' to 3') Use
1gRTF GCACCATTGTAGAGCAGGTCA Semi-quantitative
1gRTR ACCAATCGCTTCTTGATCGTC RT- PCR
3gRTF TACATACCGCCAACGAGTGAT Semi-quantitative
3gRTR GCTACAAGAACCGTATCGAAG RT- PCR
5gRTF TCAAAGCAAGTCCGGAGGAGT Semi-quantitative
5gRTR TTTGGTCAGCCCATCATTGTC RT- PCR
TuRTF AGAACACTGTTGTAAGGCTCAAC Semi-quantitative
TuRTR GAGCTTTACTGCCTCGAACATGG RT- PCR
5gNcoI F CGGCCATGGAAATGCATTCGCCTCTTCAGACTCA pICME-GFP construction
5gNcoI R TTGCCATGGCGAAAGGGCTAATCTCACGAG  
1gBglII F GCCAGATCTATGCCGTCGCAGATTCTCCAAAT pGFP-ICME-LIKE1 construction
1gSpeI R GTGACTAGTTAGAACGGACTGACCCAGTGAGCCAACTT  
3gBglII F GTCTAGATCTATGCAGTTGTCTCCGGAACG pGFP-ICME-LIKE2 construction
3gSpeI R TTAACTAGTCAAAAAGGGCTGACCCTGCCAGCCAGTT  
5gΔTM F1 GAAATGCATTCGCCTCTTCAG pICMEΔTM-GFP construction
5gΔTM R1 CGGACTTGCTTTGAGAAAAATTTTGTCATCCATCGATAGC  
5gΔTM F2 GCTATCGATGGATGACAAAATTTTTCTCAAAGCAAGTCCG  
5gΔTM R2 AAGGCATGCTACAATGATATC  
1gqRTF CTCACATCATCTTCCACCTAAATC Real-time quantitative
1gqRTR AAATCGAGAGAGAAGGGTCGT PCR
3gqRTF CCGATGTCTGAAAACAGAGAGG Real-time quantitative
3gqRTR CCGGTGAAGATAATCTGTTGG PCR
5gqRTF AGGATCCCTTACGAGGAGGT Real-time quantitative
5gqRTR AGCCAACGAGTCTTTGGTCAG PCR
TuqRTF GTGCTGAAGGTGGAGACGAT Real-time quantitative
TuqRTR AACACGAAGACCGAACGAAT PCR
Actin8qRTF TTACCCGACGGACAAGTGATC Real-time quantitative
Actin8qRTR ATGATGGCTGGAAAAGGACTTC PCR
P2 tcacttccataatcggggtctg T-DNA screening
LBa1 TggTTCACgTAgTgggCCATCg T-DNA screening