Skip to main content

Table 2

From: Identification of new polymorphic regions and differentiation of cultivated olives (Olea europaea L.) through plastome sequence comparison

Repeat Number of repeats Size Start(1) Type % Identity Region Gene position Sequence
1 3 30 9,345 D 86.67 LSC trnS-GCU-exon [CA][AC]GGA[GA]AGAGAGGGATTCGAACCCTCG[AG]TA
    37,281 D   LSC trnS-UGA-exon  
    47,117 I   LSC trnS-GGA-exon  
2 2 31 10,849 D 90.32 LSC trnG-UCC-exon 2 [AT][AG]A[CA]GATGCGGGTTCGATTCCCGCTA[CT]CCGC
    38,241 D   LSC trnG-GCC-exon  
3 1 30 14,401 P 93.33 LSC atpF - atpH AAATATGAAAAATA[TC][GA]TATTTTTCATATTT
4 2 45 40,451 D 88.89 LSC psaB-exon [AT]TGCAATAGCTA[AG]ATGATG[AG]TG[TA]GCAATATCGGTCAGCCATA[AG]AC
    42,675 D   LSC psaA-exon  
5 3 41 45,474 D 92.68 LSC ycf3-intron T[CA]CAGAACCGTAC[GA]TGAGATTTTCA[TC]CTCATACGGCTCCTC
    100,797 D   IR rps12 - trnV-GAC  
    122,052 D   SSC ndhA-intron  
6 2 31 56,736 D 90.32 LSC atpB - rbcL T[AT]CTTATTCATCCACTTGAAATTTTCAA[AG][AT]T
    56,777 I   LSC atpB - rbcL  
7 1 44 76,926 P 95.45 LSC psbT - psbN TTGAAGTAATGAGCCTCCC[CA]ATAT[TG]GGGAGGCTCATTACTTCAA
8 2 30 83,181 D 90 LSC rps8 - rpl14 AATCTA[CG]T[AT][AC]TTAATCTAGTTCTTAATCTA
    83,193 D   LSC rps8 - rpl14  
9 2 30 91,385 TR 90 IR ycf2-exon TTTCTTTTTGTC[CT]AA[GC]TCACTTC[TC]TTTTTT
    91,427    IR ycf2-exon  
10 2 36 93,791 TR 94.83 IR ycf2-exon [AG]ATATTGATG[AC]TAGTGAC[AG]ATATTGATG[AC]TAGTGAC
    93,827    IR ycf2-exon  
11 1 48 96,252 P 91.67 IR ycf15 - trnL-CAA AGAGCTCGGATCGAATCGGTAT[TA][TG][AC][TA]ATACCGATTCGATCCGAGCTCT
12 2 30 109,623 D 93.33 IR rrn 4.5 - rrn 5 CATTGTTCAA[AC]TCTTTGACAACA[CT]GAAAAA
    109,654 D   IR rrn 4.5 - rrn 5  
13 1 61 110,599 P 95.08 IR trnR-ACG - trnN-GCU AGAATTCTCAGATGTACTAGCACTGCATC[AT][AT][AT]GATGCAGTGCTAGTACATCTGAGAATTCT
14 1 36 118944 P 100 SSC ndhD - psaC AAAACCCGTGCTCCAAATATTTGGAGCACGGGTTTT
  1. D: direct, I: inverted, P: palindrome, TR: tandem repeat (imperfect).
  2. (1) The start base position of the interspersed repeats and palindromic sequences refers to the cv. Frantoio sequence.
  3. Bold nucleotides refer to the indel P32.