Skip to main content

Table 1 Excision sites of Dart-related TEs identified by transposons-display (TD) (designated as Dart-TDE) in the rice-Zizania introgressants

From: Transpositional reactivation of the Dart transposon family in rice lines derived from introgressive hybridization with Zizania latifolia

Excision sites Excision position§ Locus-specific primers (5'-3') Excised from Excision flanks
Dart-TDE-1 Chr.2
Position:11650578
Non-coding
For: tgcgcacaatcacctctatg
Rev: cttgtggtgcaaccaaccta
RZ1,
RZ2
acaatcacctctatg<Dart>aatgcacacactcat
acaatcacctctatg---------aatgcacacactcat
Dart-TDE-2 Chr.4
Position: 2633169
Non-coding
For: gtgcgcgtaatgctagaaaa
Rev: cagggagggagggattagag
RZ1, RZ2 acaatcacctctatg<Dart>aatgcacacactcat
acaatcacctctatg---------aatgcacacactcat
Dart-TDE-3 Chr.7
Position: 20137929
Non-coding
For: cccccatacttaccgcatta
Rev: cctaggtgttctgccgactc
RZ1,
RZ2,
RZ35
ttgtaaattaactcc<Dart>aaaccatctcctatc
ttgtaaattaactcc---------aaaccatctcctatc
Dart-TDE-5 Chr.11
Position:16475838
Non-coding
For: tgagtgacgtgaagccaaag
Rev: acagatcacggcagggttac
RZ2 aggtcggttaagcct<Dart>aagaaccacgaataa
aggtcggttaagcct------aagaaccacgaataa
Dart-TDE-7 Chr.4
Position:18387453
Non-coding
For: cctctaggcacctccctttt
Rev: caggagcaacaattgcatgt
RZ2 ctcccttttttttta<Dart>gaactaatgactttt
ctccctttttttaa gaactaatgactttt
Dart-TDE-8 Chr.1
Position:18893612
Non-coding
For: tggtttggaggtcggttaag
Rev: cacatgtcagccaaaaccac
RZ2 catcagattaagaaa<Dart>tccggtgaaaccatc
catcagattaagaaa---------tccggtgaaaccatc
Dart-TDE-10 Chr.11
Position:22507932
Non-coding
For: gagaagagcacgggaagttg
Rev: aactggctgttcgctcaagt
RZ2 taccgcattaaccac<Dart>ttaggtaggatacat
taccgcattaaccac---------ttaggtaggatacat
Dart-TDE-11 Chr.8
Position: 15326441
Non-coding
For: tcgtgttcccaaattcacac
Rev: catatatcccgcagaaaagca
RZ1, RZ2 cctccacctctaca<Dart>aaaatttctactgttc
cctccacctctaca--------aaaatttctactgttc
Dart-TDE-15 Chr.3
Position: 20176647
Non-coding
For: aacgagagcaagggagatgaa
Rev: ttaagccagggcaagtacacg
RZ2 tcctacgtcactg<Dart>ttgaggcgagccaaa
tcctacgtcactg---------ttgaggcgagccaaa
Dart-TDE-16 Chr.9
Position: 21368076
Non-coding
For: gtgcatggattttgaccttta
Rev: ctgtgctcacttcgctactacta
RZ1 atattgccatttaa<Dart>gtgtcatcgcctta
atattgccatttaa--------gtgtcatcgcctta
Dart-TDE-19 Chr.10
Position: 7832680
Non-coding
For: ggtgtaacgattgctaaggcg
Rev: agtggggggagagtaagatga
RZ2 tcttttttttacgca<Dart>tgcagaggtgacg
tcttttttttacgca<Dart>tgcagaggtgacg
Dart-TDE-20 Chr.11
Position: 7910449
Os11g0247800 exon
For: agagttcttgccaaccatgc
Rev: ggaagagggaaaaaccaagc
RZ1, RZ2 tctaatacctctag<Dart>gactgctttccacatg
Tctaatacctctag--------gactgctttccacatg
Dart-TDE-21 Chr.7
Position: 16720991
Non-coding
For: cgatcgagaatttccgagac
Rev: tggtctgttcgttgtccaaa
RZ1 tttcaccccctatat<Dart>tggtaccatcaattt
Tttcaccccctatat--------tggtaccatcaattt
Dart-TDE-23 Chr.6
Position: 6273602
Non-coding
For: cttttgggctgtgatggagt
Rev: ttaaggacgatgccaaaacc
RZ2 ttctgtccaccccta<Dart>gctggtatttatat
ttctgtccaccccta--------gctggtatttatat
Dart-TDE-25 Chr.6
Position: 26631010
Non-coding
For: cctcggtttccattagca
Rev: gtacggcctggcaagtga
RZ1, RZ2 ttttgtccaccccta<Dart>tctactcctagttgc
Ttttgtccaccccta--------tctactcctagttgc
  1. §Excisions refer to events occurred in one or more of the three introgressants (RZ1, RZ2 and RZ35). Naturally, the corresponding loci in Matsumae all contain a copy of Dart-related TE, whereas in Nipponbare only some of the loci contain the element, pointing to genotypic polymorphism with regard to presence/absence of the Dart-related TEs for a given genomic locus.