Skip to main content

Table 2 Genes, primers, length of amplicons and amplification efficiency

From: Modulation of flavonoid biosynthetic pathway genes and anthocyanins due to virus infection in grapevine (Vitis viniferaL.) leaves

Gene1 Primer sequence 5'-3' (forward/reverse) Amplicon length (bp) qPCR efficiency Reference GenBank accession number*
a) Reference genes
Ubiquitin TCTGAGGCTTCGTGGTGGTA/AGGCGTGCATAACATTTGCG 99 2.16 [82] GU585868
Actin CTTGCATCCCTCAGCACCTT/TCCTGTGGACAATGGATGGA 82 2.11 [56] GU585869
GAPDH TTCTCGTTGAGGGCTATTCCA/CCACAGACTTCATCGGTGACA 70 1.84 [56] GU585870
EF1-a GAACTGGGTGCTTGATAGGC/AACCAAAATATCCGGAGTAAAAGA 164 1.90 [56] GU585871
SAND CAACATCCTTTACCCATTGACAGA/GCATTTGATCCACTTGCAGATAAG 76 1.88 [56] GU585872
NAD5 GATGCTTCTTGGGGCTTCTTGTT/CTCCAGTCACCAACATTGGCATAA 181 1.82 [83] GU585873
b) Candidate genes
PAL TCTGGTGGAAGGAATCCAAG/CAAAGTGCCACCAGGTAGGT 230 1.77 [62] GU585850
CHS1 AGCCAGTGAAGCAGGTAGCC/GTGATCCGGAAGTAGTAAT 155 1.74 [61] GU585851
CHS2 TCTGAGCGAGTATGGGAACA/AGGGTAGCTGCGTAGGTTGG 294 1.80 [61] GU585852
CHS3 TCACTTGGACAGCCTTGTTG/CAATTCGAACATGGGCTTCT 106 1.87 $ GU585853
CHI1 CAGGCAACTCCATTCTTTTC/TTCTCTATCACTGCATTCCC 103 1.69 [84] GU585854
CHI2 TCCAGATCAAGTTCACAGCA/GAAACAAGAGCCTCAAAGAA 127 1.60 [84] GU585855
F3'H ATTCGCCACCCTGAAATGAT/AGCCGTTGATCTCACAGCTC 196 1.82 [15] GU585856
F3'5'H GAAGTTCGACTGGTTATTAACAAAGAT/
AGGAGGAGTGCTTTAATGTTGGTA
156 1.68 [15] GU585857
F3H1 CCAATCATAGCAGACTGTCC/TCAGAGGATACACGGTTGCC 69 1.83 [84] GU585858
F3H2 CTGTGGTGAACTCCGACTGC/CAAATGTTATGGGCTCCTCC 129 1.70 [84] GU585859
DFR GAAACCTGTAGATGGCAAGA/GGCCAAATCAAACTACCAGA 114 1.85 [84] GU585860
LDOX AGGGAAGGGAAAACAAGTAG/ACTCTTTGGGGATTGACTGG 109 1.76 [84] GU585861
UFGT GGGATGGTAATGGCTGTGG/ACATGGGTGGAGAGTGAGTT 152 1.74 [84] GU585862
MybA1 TAGTCACCACTTCAAAAAGG/GAATGTGTTTGGGGTTTATC 66 1.67 [84] GU585863
FLS1 CAGGGCTTGCAGGTTTTTAG/GGGTCTTCTCCTTGTTCACG 154 1.82 [85] GU585864
LAR1 AAATGAACTCGCATCTGTGT/CTGTGGGATGATGTTTTCTC 109 1.75 [82] GU585865
LAR2 TGATATCAGCTGTGGGTGGA/CCCAAATTCTGATGGAAGGA 104 1.74 $ GU585866
ANR GCTGCTGTTACCATCAATCA/GCAGGATAGCCCCAAGTAGG 113 1.62 [82] GU585867
  1. 1See legends for Figure 1 and Figure 3 for names of genes
  2. *Accession numbers indicate sequences generated from this study.
  3. $Primers were designed based on sequence available in GenBank.