Skip to main content

Table 4 Primer pairs used in the study

From: Molecular characterization of vernalization loci VRN1 in wild and cultivated wheats

Name Sequence Reference
AP1_ProDel_F1 5'ACAGCGGCTATGCTCCAG3' [3]
AP1_ProDel_R1 5'TATCAGGTGGTTGGGTGAGG3' [3]
AP1_2F 5'CTGTGGTGTGTGTTTGTGGCGAGAG3' Present study
AP1_2R 5'ACCCTACGCCCCTACCCTCCAACAC3'  
VRN1-AF 5'GAAAGGAAAAATTCTGCTCG3' [10]
VRN1-BF 5'CAGTACCCCTGCTACCAGTG3' [10]
VRN-DF 5'CGACCCGGGCGGCACGAGTG3' [10]
VRN1-1NT1R 5'TGCACCTTCCC(C/G)CGCCCCAT3' [10]