Skip to main content

Table 4 Characteristics of gene specific real-time RT-PCR assays

From: Validation of reference genes as internal control for studying viral infections in cereals by quantitative real-time RT-PCR

Gene symbol Gene name Accession No. Primer sequence (5'→3') Amplicon size PCR efficiency
GAPDH Glyceraldehyde-3-phosphate dehydrogenase AK251456 Forward: TGTCCATGCCATGACTGCAA 105 101%
TUBA Alpha tubulin-2B AK250165 Forward: TTCGCCCGTGGTCATTACA 113 100%
TUBB Beta-tubulin U76897 Forward: CAAGGAGGTGGACGAGCAGATG 84 97%
ELF1A Elongation factor-1 alpha AF479046 Forward: CAGTGCTGGACTGCCACA 164 91%
EIF4A Eukaryotic initiation factor 4a EU850433 Forward: TTGTGCTGGATGAAGCTGATG 76 99%
18S rRNA 18S ribosomal RNA M82356 Forward: GTGACGGGTGACGGAGAATT 151 85%, 99%*
28s rRNA 28S ribosomal RNA M82206 Forward: CCTGATCTTCTGTGAAGGGTTCGA 172 94%
BYDV cp coat protein of BYDV EF521849 Reverse:TGTTGAGGAGTCTACCTATTTG 294 99%
  1. PCR efficiency was calculated as follows: efficiency = 10 (1/slope) - 1, expressed as a percentage.
  2. * 85% is the efficiency of assays in which samples of wheat were analysed, 99% efficiency was recorded for barley and oat samples.