Skip to main content

Table 1 The primers of genes detected by RT-PCR and real-time PCR analyses.

From: Identification and characterization of genes associated with tapping panel dryness from Hevea brasiliensislatex using suppression subtractive hybridization

Putative Genesa(Accession No.) RT-PCR primers (5'-3') Real-Time PCR primers (5'-3')
WIP (GO349116) F:GACATCGTATCATCAGGAAAAG F: CGTATCATCAGGAAAAGTTGG
  R: CTCTCACCTGGGTAATTATC R: GCTAGAATCGCAGCCTTCAG
SAP (GO349117) F: GAATACGAACCGTGAAAGCG F: GTGGCCTATCGATCCTTTAG
  R: CTAGGTTGAATTACCATCGC R: ACGTCGCTATGAACGCTTGG
HSP (GO349120) F: TTGTCCCTTAGAGCTTGTG F: GTTGTCCCTTAGAGCTTGTG
  R: CTCCACCAAGAGTGGTGATG R: GACCGTGTTGTTGATTCTCC
MT (GO349141) F: ACCAAGGCAGAACTGAAGG F: CACCAAGGCAGAACTGAAGG
  R: CCACTTTCTGATTCCTCCTC R: CTGGATGTAGGATTCATCGG
CP450 (GO349147) F: GACAAGGGGAATCCGACTG F: CAATGTGATTTCTGCCCAGTG
  R: CCACACGAGATTTCTGTTCTC R: TGACGAGGCATTTGGCTACC
Cullin (GO349159) F: GTCCAATTGGTAATGCTTAAAC F: CCTGCTCAAGCTATCCCTTC
  R:GGAAAGAGCCCATGAGTAAAG R: GTCACGATTTCTGGCCAACC
UL (GO349162) F: AGGATTAGACTTGACATAGCG F: GATGGCCGATGGTTGAAAATG
  R: CTCCAATTTATCAGTGCCGC R: CTGGATCTGAGTTTGCTGTTG
PPA (GO349189) F: GTTGAACCGGAGGAATTTCC F: GAATCGGATTCGTGGAAGTG
  R: TCATGGCCAGAAATGTCTCC R: CTGTCCCTCAATCTCAAAAGG
LPH (GO349193) F: TGTGCCACCAAGGTGCAAAC F: GCAAGGGATCCAGGTTCATC
  R: GTCGTGGCAAACATACGTTG R: CACCTTATGTGCGACATCGAC
DBP (GO349205) F: TGAACTGGAACAGAGCAAGC F:GATGAACTGGAACAGAGCAAG
  R: TTGACCCCGAACAATCTCAG R: CTGTTCACGTTCTTTCAGAAC
TCTP (GO349268) F: GCCTCCATCAGCGTTTTCAG F: GTGTCAACAACTTGATGAACC
  R: CCCTCAATGATATCGACACC R: ATGAGGGTGTTGATGACCAG
SRPP (GO349270) F: CTGAAGAGGTGGAGGAAGAG F: CCTTTATGCCAAGGACATATC
  R: CAGAGCTTTTGCGCCTTCCT R: GTCTACAAACTTGACAGCCTC
AGPS (GO349278) F: TTCTCACTCTCTCACGATGG F: CCATACAATCTTACACTCACC
  R: CGAGGTTCATTCCACACATC R: CTATGTCCAGCTCGTCCTTC
HH2A (GO349279) F: AAGAATTCCGCGGCCTCCTG F: GAAGCCAGTTTCTAGGTCTG
  R:ACTCGAGAACGGCAGCCAAG R: GGCAGCCAAGTAAACTGGAG
CT (GO349296) F: ATCCTTCTCCTGATCTCCTC F: TTCTCCTGATCTCCTCCAAG
  R: GGGAGCGAGAGGAAGCTAG R: CAAACAAGAGCGTTACCTCG
GR (GO349295) F: TGAGGCATTGAGTCTGGAAG F: TGAGGCATTGAGTCTGGAAG
  R: TGCTCTATTGCCTGCTCTTC R: GAAAACTAGGTCCACAGTGG
VPSAP (GO349303) F: ATTGTATGAGGACTCGAGATC F: GAGGACTCGAGATCAAAGTG
  R:AGAACTTTGCTGAGCTCTATG R:GAAGACAAAGATGAAAGAGTGG
HbMyb1 (GO349308) F: AGGATGAACCTGATCGATGG F: CCAGACACCAAGTCTCCTTC
  R: CTTCTCTCATCCTTCCCTCC R: ATCCTTTGGCCATGCCAACC
CHP (GO349321) F:CTCAACAACTCCAGTTGGTG F: TCTTCAAAGCTCAACAACTCC
  R: ACCACTTCGACATATCCTCC R: TTGCAGGCTCTCAATTGCTC
Y17H05 (GO349330) F:GTGATGCATGATGTGAGGAG F: TGGTGATGCATGATGTGAGG
  R:GAAATCCTAGGGCATCATTG R: GTAAGACCATTGGACAAACGG
18s rRNA gene (AB268099) F: GGTCGCAAGGCTGAAACT F: GCTCGAAGACGATCAGATACC
  R: ACGGGCGGTGTGTACAAA R: TTCAGCCTTGCGACCATAC
  1. a WIP, SAP, HSP, MT, CP450, UL, PPA, LPH, DBP, TCTP, SRPP, AGPS, HH2A, CT, GR, VPSAP, HbMyb1, CHP and Y17H05 represent Wound-induced protein, Senescence-associated protein, Heat shock protein, Metacaspase type II, Cytochrome P450-like TBP protein, Ubiquitin ligase, Posphotyrosyl phosphatase activator, Latex profilin Hev b8, DNA-binding protein RAV1, Translationally controlled tumor protein, Small rubber particle protein, Alpha-1,4-glucan-protein synthase, Histone H2A, Copper transporter, Glutathione reductase, Vacuolar protein sorting-associated protein, HbMyb1 transcription factor, Conserved hypothetical protein and Hevea brasiliensis clone Y17H05 mRNA, respectively. F and R represent forward and reverse primers, respectively.