Skip to main content

Table 2 Primer sequences used for PCR amplification

From: Assessment of FAE1 polymorphisms in three Brassica species using EcoTILLING and their association with differences in seed erucic acid contents

Primer name Forward primer sequence (5'→3') Reverse primer sequence (5'→3')
FAE1-A8 GGCACCTTTCATCGGACTAC GATAGAACTCGGGGTTTTAGTTG
FAE1-C3 GGCACCTTTCATCGGACTAC TTAACAGAAGATCCTTAACCCC
ECOT1 CGGACCACAAAAGAGGATCC GTCTCCTTGTTGCACGCAACG
ECOT2 CGTATGCTCTTGTGGTGAGC GAGAAACATCGTAGCCATC
FAE1-rapa ATGACGTCCGTTAACGTTAAGC AAAAGAAACGAAAGAGAGCA
FAE1-oleracea CTCCGACACACACACTGAGCA GGGTTTTAGGGTTAAAGATGGTC
M13 CACGACGTTGTAAAACGAC GGATAACAATTTCACACAGG