Skip to main content

Table 1 PCR Primers used in this study

From: Transcriptional regulation of the grape cytochrome P450 monooxygenase gene CYP736B expression in response to Xylella fastidiosa infection

Name Sequences (5' - 3') Comments
P450F1 TGAAAATTAACCAGCCACCAT Gene and cDNA cloning
P450R1 TTATATCATTTGTGAAAGC GACAAG Gene and cDNA cloning
P450F2 TGCATGGACTGATGCAGAC Expression detection in gel
P450R2 CTCCTCATTCATGTCCAACTC Expression detection in gel
P450F3 TGGAGTTGCTCAGCAGCCATA Internal primer for DNA sequencing
P450R3 TATATGGAA GCCATCGACTGTG Internal primer for DNA sequencing
5'UTRF1 TGCAGCTTCATATCTTGGGTTTTCTC 5'UTR cloning (1000 bp)
5'UTRR3 GGTGGCTGGTT AATTTTCAGTATTCAG 5'UTR cloning (1000 bp)
3'UTRF1 ATATAATCTCTGTATCATTGCCAACTGAG 3'UTR cloning (600 bp)
3'UTRR1 ATGCTAAACATCAAATCGAATACTCTCA 3'UTR cloning (600 bp)
SYBR-P450F1 TGCATGGACTGATGCAGAC Real-time qPCR for gene expression
SYBR-P450R1 CTCCTCATTCATGTCCAACTC Real-time qPCR for gene expression
SYBR-P450F2 CCAACATCAAAGCTATATCTTTG Real-time qPCR for pre-mRNA splicing
SYBR-P450R2 TGGAGGCTGCCATCAT ATC Real-time qPCR for pre-mRNA splicing
P450-5'RACE GSP2 CGATACTTTTTGGATAGAGCTTGTAGAGC First 5'RACE
P450-5'RACE GSP3 CGACAAGCTCCCTAACATATGCATATT Second 5'RACE
P450-3'RACE GSP1 CGAGCAACTTGTTCATTGCTTTGAT First 3'RACE
P450-3'RACE GSP2 CGAAGA TAACATGTTGGCAAGTGAGTT Second 3'RACE
SYBR-P450B 5'UTRF1 ACTGACTTCTAGTTTAAATTTTTCTT Real-time qPCR for 5'RACE
SYBR-P450B 5'UTRR1 TGGCTGGTTAATTTTCAGTATT Real-time qPCR for 5'RACE
SYBR-P450B 3'UTRF1 ATATAATCTCTGTATC ATTGCCAA Real-time qPCR for 3'RACE
SYBR-P450B 3'UTRR1 ACTACCAGATGAAAATCATTAAAT Real-time qPCR for 3'RACE
P450-5'RACE GSP3 CGACAAGCTCCCTAACATATGCATATT 5' primer extension
P450-3'RACE GSP2 CGAAGA TAACATGTTGGCAAGTGAGTT 3' primer extension
-300UF AGTCATATATGACTTAGCAAGAGAACTCCAC PCR for pre-mRNA splicing at -300 TSS
-140UF AACCGCACCTTATC CTCTTCACAA PCR for pre-mRNA splicing at -140 TSS
-60UF TGAAACCACCCAAGAACTTCAAAAC PCR for pre-mRNA splicing at -60 TSS
++70UR CATAAAGCATAAAGCGTTATTATTCATATTT PCR for pre-mRNA splicing at ++70 poly(A) site
++200UR CTAAGTTCCATATTCT TCCTTCTTAAGTTCA PCR for pre-mRNA splicing at ++200 poly(A) site
++260UR ACTCAGAACTAAGTTTTATTTCACTTGATCAA PCR for pre-mRNA splicing at ++260 poly(A) site