Open Access

Identification of flowering genes in strawberry, a perennial SD plant

  • Katriina Mouhu1, 2,
  • Timo Hytönen1, 3Email author,
  • Kevin Folta4,
  • Marja Rantanen1,
  • Lars Paulin5,
  • Petri Auvinen5 and
  • Paula Elomaa1
Contributed equally
BMC Plant Biology20099:122

DOI: 10.1186/1471-2229-9-122

Received: 10 December 2008

Accepted: 28 September 2009

Published: 28 September 2009

Abstract

Background

We are studying the regulation of flowering in perennial plants by using diploid wild strawberry (Fragaria vesca L.) as a model. Wild strawberry is a facultative short-day plant with an obligatory short-day requirement at temperatures above 15°C. At lower temperatures, however, flowering induction occurs irrespective of photoperiod. In addition to short-day genotypes, everbearing forms of wild strawberry are known. In 'Baron Solemacher' recessive alleles of an unknown repressor, SEASONAL FLOWERING LOCUS (SFL), are responsible for continuous flowering habit. Although flower induction has a central effect on the cropping potential, the molecular control of flowering in strawberries has not been studied and the genetic flowering pathways are still poorly understood. The comparison of everbearing and short-day genotypes of wild strawberry could facilitate our understanding of fundamental molecular mechanisms regulating perennial growth cycle in plants.

Results

We have searched homologs for 118 Arabidopsis flowering time genes from Fragaria by EST sequencing and bioinformatics analysis and identified 66 gene homologs that by sequence similarity, putatively correspond to genes of all known genetic flowering pathways. The expression analysis of 25 selected genes representing various flowering pathways did not reveal large differences between the everbearing and the short-day genotypes. However, putative floral identity and floral integrator genes AP1 and LFY were co-regulated during early floral development. AP1 mRNA was specifically accumulating in the shoot apices of the everbearing genotype, indicating its usability as a marker for floral initiation. Moreover, we showed that flowering induction in everbearing 'Baron Solemacher' and 'Hawaii-4' was inhibited by short-day and low temperature, in contrast to short-day genotypes.

Conclusion

We have shown that many central genetic components of the flowering pathways in Arabidopsis can be identified from strawberry. However, novel regulatory mechanisms exist, like SFL that functions as a switch between short-day/low temperature and long-day/high temperature flowering responses between the short-day genotype and the everbearing 'Baron Solemacher'. The identification of putative flowering gene homologs and AP1 as potential marker gene for floral initiation will strongly facilitate the exploration of strawberry flowering pathways.

Background

Transition from vegetative to reproductive growth is one of the most important developmental switches in plant's life cycle. In annual plants, like Arabidopsis, flowering and consequent seed production is essential for the survival of the population until the following season. To assure timely flowering in various environments, Arabidopsis utilizes several genetic pathways that are activated by various external or internal cues. Light and temperature, acting through photoperiod, light quality, vernalization and ambient temperature pathways, are the most important environmental factors regulating flowering time [1]. Moreover, gibberellin (GA) and autonomous pathways promote flowering by responding to internal cues [2, 3]. In contrast to annual plants, the growth of perennials continues after generative reproduction, and the same developmental program is repeated from year to year. Regulation of generative development in these species is even more complex, because other processes like juvenility, winter dormancy and chilling are tightly linked to the control of flowering time.

In Arabidopsis photoperiodic flowering pathway, phytochrome (phy) and cryptochrome (cry) photoreceptors perceive surrounding light signals and reset the circadian clock feedback loop, including TOC1 (TIMING OF CAB EXPRESSION), CCA1 (CIRCADIAN CLOCK ASSOCIATED 1) and LHY (LATE ELONGATED HYPOCOTYL) [47]. The central feature in the photoperiodic flowering is the clock generated evening peak of CO (CONSTANS) gene expression [8]. In long-day (LD) conditions, CO peak coincidences with light resulting in accumulation of CO protein in the leaf phloem and consequent activation of the expression of FT (FLOWERING LOCUS T) [9]. FT protein, in turn, moves to the shoot apex, and together with FD triggers floral initiation by activating floral identity gene AP1 (APETALA 1) [10, 11]. FT, together with SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1) and LFY (LEAFY) form also convergence points for different flowering pathways, and therefore are called flowering integrator genes [12].

In winter-annual ecotypes of Arabidopsis, MADS-box gene FLC (Flowering Locus C) prevents flowering by repressing FT and SOC1, and vernalization is needed to nullify its function [13]. The major activator of FLC is FRI (FRIGIDA) [14], but several other proteins, including for example FRL1 (FRIGIDA-LIKE 1) [15], PIE (PHOTOPERIOD INDEPENDENT EARLY FLOWERING 1) [16], ELF7 and ELF8 (EARLY FLOWERING 7 and 8) [17], and VIP3 (VERNALIZATION INDEPENDENCE 3) [18] are also needed to maintain high FLC expression. During vernalization, FLC is down-regulated by VRN2-PRC2 (Vernalization 2 - Polycomb Repressive Complex 2) protein complex containing low temperature activated VIN3 (VERNALIZATION INSENSITIVE3), allowing plants to flower [19, 20].

Autonomous and GA pathways respond to endogenous cues to regulate flowering time. The role of the autonomous pathway is to promote flowering by lowering the basal level of FLC transcription [3]. Autonomous pathway consists of few sub-pathways, which include for example RNA processing factors encoded by FCA, FPA, FLK (FLOWERING LOCUS K), FY and LD (LUMINIDEPENDENS) [21], putative histone demethylases LDL1 and LDL2 (LSD1-LIKE 1 and 2) [22], and deacetylases FLD (Flowering locus D) and FVE [23, 24]. GA pathway is needed to induce LFY transcription and flowering in short-day (SD) conditions [25].

Strawberries (Fragaria sp.) are perennial rosette plants, belonging to the economically important Rosaceae family. Most genotypes of garden strawberry (Fragaria × ananassa Duch.) and wild strawberry (F. vesca L.) are Junebearing SD plants, which are induced to flowering in decreasing photoperiod in autumn [26, 27]. In some genotypes, flowering induction is also promoted by decreasing temperatures that may override the effect of the photoperiod [27, 28]. In contrast to promotion of flowering by decreasing photoperiod and temperature, these "autumn signals" have opposite effect on vegetative growth. Petiole elongation decreases after a few days, and later, around the floral transition, runner initiation ceases and branch crowns are formed from the axillary buds of the crown [29, 30]. Crown branching has a strong effect on cropping potential as it provides meristems that are able to initiate inflorescences [31].

In addition to SD plants, everbearing (EB) genotypes are found in garden strawberry and in wild strawberry [29, 32]. Environmental regulation of induction of flowering in EB genotypes has been a topic of debate for a long time. Several authors have reported that these genotypes are day-neutral [29, 33]. Recent findings, however, show that long-day (LD) accelerates flowering in several EB Fragaria genotypes [34, 35]. Interestingly, in wild strawberry genotype 'Baron Solemacher' recessive alleles of SFL gene locus (SEASONAL FLOWERING LOCUS) have been shown to cause EB flowering habit [36]. SFL has not been cloned, but it seems to encode a central repressor of flowering in wild strawberry. Consistent with the repressor theory, LD grown strawberries have been shown to produce a mobile floral inhibitor that is able to move from mother plant to the attached runner plant [37]. GA is one candidate corresponding to this inhibitor, since exogenously applied GA has been shown to repress flowering in strawberries [38, 39].

Identification of central genes regulating flowering time and EB flowering habit, as well as those controlling other processes affecting flowering, is an important goal that would greatly accelerate breeding of strawberry and other soft fruit and fruit species of Rosaceae family. In this paper, we have searched Fragaria homologs with the known Arabidopsis flowering time genes by EST sequencing and bioinformatics analysis. Dozens of putative flowering genes corresponding to all known genetic pathways regulating flowering time were identified. The expression analysis of several candidate flowering time genes revealed only few differences between the SD and EB wild strawberries, including the presence or absence of AP1 mRNA in the apices of EB and SD genotypes, respectively. Our data provides groundwork for detailed studies of flowering time control in Fragaria using transcriptomics, functional genomics and QTL mapping.

Results

Environmental regulation of flowering in two EB genotypes of wild strawberry

We studied the effect of photoperiod and temperature on flowering time in two EB genotypes, 'Baron Solemacher', which contains recessive alleles in SFL locus [40, 41], and 'Hawaii-4'. Flowering time was determined by counting the number of leaves in the main crown before formation of the terminal inflorescence. In SD genotypes of the wild strawberry, SD (<15 h) or, alternatively, low temperature (~10°C) is needed to induce flowering [27]. In EB genotypes 'Baron Solemacher' and 'Rugen', instead, LD and high temperature has been shown to accelerate generative development [35], but careful analysis of the environmental regulation of flowering induction has so far been lacking.

Both 'Baron Solemacher' and 'Hawaii-4' produced five to six leaves in LD at 18°C before the emergence of the terminal inflorescence showing that they are very early-flowering in favorable conditions (Figure 1A and 1B). In 'Baron Solemacher', low temperature (11°C) or SD treatment for five weeks at 18°C clearly delayed flowering, but low temperature did not have an additional effect on flowering time in SD. Also in 'Hawaii-4', SD and low temperature delayed flowering, but all treatments differed from each other. Compared to the corresponding LD treatment, SD at 18°C doubled the number of leaves, and low temperature (11°C) delayed flowering time by about three leaves in both photoperiods. Thus, flowering induction in these EB genotypes is oppositely regulated by photoperiod and temperature than previously shown for the SD genotypes [27].
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-9-122/MediaObjects/12870_2008_Article_464_Fig1_HTML.jpg
Figure 1

Environmental regulation of flowering in everbearing wild strawberries. The effect of photoperiod (SD 12 h, LD 18 h) and temperature (11/18°C) on the flowering time of 'Baron Solemacher' (A) and 'Hawaii-4' (B). Seeds were germinated in LD at 18°C, and seedlings were exposed to the treatments for five weeks, when the cotyledons were opened. After treatments, plants were moved to LD at 18°C and flowering time was recorded as number of leaves in the main crown before the terminal inflorescence. Values are mean ± SD. Pairwise comparisons between the treatments were done by Tukey's test, and statistically significant differences (p ≤ 0.05) are denoted by different letters above the error bars.

Construction and sequencing of subtracted cDNA libraries

We constructed two subtracted cDNA libraries from LD grown EB genotype 'Baron Solemacher' and SD genotype, in order to identify differentially expressed flowering time genes in these genotypes. Plants were grown in LD conditions, where the SD genotype stays vegetative and the EB plants show early flowering. Pooled shoot apex sample covering the floral initiation period was collected from the EB genotype, and vegetative apices of the same age were sampled from the SD genotype. Suppression subtractive hybridization (SSH), the method developed for extraction of differentially expressed genes between two samples [42], was used to enrich either flowering promoting or flowering inhibiting transcripts from EB and SD genotypes, respectively.

A total of 1172 ESTs was sequenced from the library enriched with the genes of the SD genotype (SD library subtracted with EB cDNA) and 1344 ESTs from the library enriched with the EB genes (EB library subtracted with cDNA of the SD genotype). 970 SD ESTs [Genbank:GH202443-GH203412] and 1184 EB ESTs [GenBank:GH201259-GH202442] passed quality checking. Pairwise comparison of these EST datasets revealed that there was very little overlap between the libraries. However, general distribution of the sequences to functional categories (FunCat classification) did not reveal any major differences between the two libraries (Additional file 1).

BLASTx searches against Arabidopsis, Swissprot and non-redundant databases showed that over 70% of the ESTs gave a match in one or all of the three databases (Table 1). Moreover, tBLASTx comparison with different genomes revealed highest number of hits with Populus trichocarpa (Table 1). We also performed tBLASTx searches against TIGR plant transcript assemblies of Malus × domestica, Oryza sativa and Vitis vinifera and found hits for 64-76% of ESTs in these assemblies. Finally, the comparison of our sequences with a current Fragaria unigene list at the Genome Database for Rosaceae (GDR) showed that 38.2% of our ESTs are novel Fragaria transcripts. Taken together, depending on the analysis, 15-22% of sequences from SD genotype and 22-27% of EB sequences encode novel proteins, or originate from untranslated regions of mRNA. Moreover, the high number of novel Fragaria sequences in our libraries indicates that SSH method efficiently enriched rare transcripts in the libraries.
Table 1

The comparison of F. vesca ESTs with different databases.

  

WT

EB

  

number

average length

number

average length

A)

Raw

1172

946

1344

965

 

Poor Quality

202

1037

160

1066

 

Singletons/ESTs

970

452

1184

451

  

number

%

number

%

B)

Arabidopsis

695

72

781

66

 

Swissprot

483

50

570

48

 

Non-redundant

749

77

852

72

 

In all 3 datab.

752

78

862

73

C)

Malus

741

76

874

74

 

Oryza

689

71

807

68

 

Vitis

666

69

761

64

 

Populus

829

85

928

78

D)

No protein hits

218

22

322

27

 

No Fragaria hits

370

38

454

38

Average numbers, lengths and percentages of ESTs from EB and SD genotypes. A) numbers and average lengths of raw and poor quality ESTs, and singletons, B) numbers and percentages of BLASTx hits against protein databases, C) numbers and percentages of tBLASTx hits against TIGR plant transcript assemblies of Malus x domestica, Oryza sativa and Vitis vinifera and against Populus genome database, D) numbers and percentages of novel ESTs.

Identification of flowering time genes

Flowering related genes were identified from our libraries by BLASTx searches as described above and fourteen putative flowering time regulators were identified; four gene homologs were present only in EB library, eight in SD library, and two genes in both libraries. In figure 2, we have summarized the Arabidopsis flowering pathways and highlighted the putative homologous genes identified from our EST collection. In general, candidate genes for all major pathways were identified. In addition, 118 Arabidopsis flowering time genes were used as a query to search publicly available GDR Fragaria EST and EST contig databases using tBLASTn. Sequences passing cut-off value of 1e-10 were further analysed by BLASTx algorithm against Arabidopsis protein database, and those returning original Arabidopsis protein were listed. Moreover, sequences that were absent from Fragaria databases were similarly searched from GDR Rosaceae EST database. In these searches, 52 additional Fragaria sequences were identified. Moreover, the total number of 88 homologs of Arabidopsis flowering time genes were found among all available Rosaceae sequences (Additional file 2).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-9-122/MediaObjects/12870_2008_Article_464_Fig2_HTML.jpg
Figure 2

A simplified chart showing Arabidopsis flowering pathways and corresponding gene homologs in Fragaria. Gene homologs found in cDNA libraries produced from SD and EB genotypes are surrounded by blue and red boxes, respectively. Arrows indicate positive regulation and bars negative regulation.

Most genes of the Arabidopsis photoperiodic pathway were found also in Fragaria, and some of the lacking genes were present among Rosaceae ESTs (Table 2, Additional file 2). We found several genes encoding putative Fragaria photoreceptor apoproteins including phyA, phyC, cry2, ZTL (ZEITLUPE) and FKF1 (FLAVIN BINDING KELCH REPEAT F-BOX 1) [43]. Of the central circadian clock genes, homologs of LHY and TOC1 [5, 7] were present in our EST libraries and GDR, respectively, but CCA1 [6] was lacking from both Fragaria and Rosaceae databases. Furthermore, a putative Fragaria CO from the flowering regulating output pathway has been cloned earlier [44]. Among the regulators of CO transcription and protein stability, GI (GIGANTEA) [45] was identified from Rosaceae and putative COP1, SPA3 and SPA4 [46, 47] from Fragaria. In addition to genes of the photoperiodic pathway, homologs for both known sequences belonging to light quality pathways, PFT1 (PHYTOCHROME AND FLOWERING TIME 1) and HRB1 (HYPERSENSITIVE TO RED AND BLUE 1) [48, 49], were found from our EST libraries.
Table 2

The list of genes belonging to the photoperiodic flowering pathway.

Gene

AT gene locus

Biological function

Act./Repr. +/-

Reference

Fragaria

E-value

Photoreceptors and clock input

PhyA

AT1G09570

Red light photoreceptor

+

[78]

VES-002-C06

5E-33

PhyB

AT2G18790

Red light photoreceptor

-

[79]

nf

 

CRY1

AT4G08920

Blue light photoreceptor

+

[79]

nf

 

CRY2

AT1G04400

Blue light photoreceptor

+

[79]

DY669844

2E-110

ZTL

AT5G57360

F-box protein/blue light photoreceptor

+

[80]

EX668764

2E-97

FKF1

AT1G68050

F-box protein/blue light photoreceptor

+

[65]

DY671170

2E-54

ELF3

AT2G25920

Unknown

-

[60]

DY675323

3E-33

FYPP3

AT1G50370

Ser/Thr-specific protein phosphatase 2A

-

[81]

BAR-009-A02

1E-56

SRR1

AT5G59560

Unknown

-

[82]

CO817759

1E-10

Circadian clock

LHY

AT1G01060

Myb domain TF

-

[7]

VES-005-E09

9E-19

CCA1

AT2G46830

Myb domain TF

-

[6]

nf

 

TOC1

AT5G61380

Pseudo-response regulator

-

[5]

DY673134

1E-75

LUX

AT3G46640

Myb TF

-

[83]

DY668516

3E-43

ELF4

AT2G40080

Unknown

-

[84]

EX674323

2E-25

GI

AT1G22770

Unknown

+

[45]

nf

 

PRR5

AT5G24470

Pseudo-response regulator

+

[85]

DY676242

3E-56

PRR7

AT5G02810

Pseudo-response regulator

+

[85]

VES-013-D12

5E-52

ELF6

AT5G04240

Jumonji/zinc finger-class TF

-

[86]

VES-002-F05

1E-45

Output pathway

CO

AT5G15840

putative zinc finger TF

+

[8]

DY672035

2E-45

CDF1

AT5G62430

 

-

[65]

nf

 

FT

AT1G65480

Phosphatidylethanolamine binding

+

[11]

nf

 

TFL1

AT5G03840

Phosphatidylethanolamine binding

-

[87]

nf

 

FD

AT4G35900

bZIP TF

+

[10]

EX675574

2E-14

COP1

AT2G32950

E3 ubiquitin ligase

-

[46]

DY667888

1E-94

SPA1

AT2G46340

WD domain protein

-

[47]

nf

 

SPA3

AT3G15354

WD domain protein

-

[47]

DY671873

3E-24

SPA4

AT1G53090

WD domain protein

-

[47]

DY671245

2E-83

RFI2

AT2G47700

RIng domain zinc finger

-

[88]

nf

 

HAP3b

AT5G47640

CCAAT-binding TF

+

[89]

EX658204

2E-60

The most important genes belonging to the photoperiodic pathway in Arabidopsis and their biological function are presented. Floral activators and repressors are indicated by + and - marks, respectively. Moreover, the presence or absence of homologous sequence in Fragaria sequence databases and E-value of BLASTx comparison against Arabidopsis are indicated. Sequences found in our libraries are named BAR and VES for everbearing genotype 'Baron Solemacher' and short-day genotype, respectively. Other ESTs and EST contigs are found from Genome Database for Rosaceae http://www.bioinfo.wsu.edu/gdr/. More complete list is available in Additional file 2.

For the vernalization pathway, we were not able to find FLC-like sequences from our EST libraries or public Fragaria or Rosaceae EST databases by tBLASTn searches although we used the FLC and FLC-like sequences from Arabidopsis (MAF1-MAF5, MADS AFFECTING FLOWERING 1-5) and several other plant species as query sequences [13, 50, 51]. Similarly, also FRI [14] was lacking from Rosaceae ESTs but putative FRL (FRIGIDA-LIKE) [15] sequences were identified in Fragaria. In addition, we identified several gene homologs belonging to the FRI complex as well as other regulatory complexes (SWR1, PAF) involved in promoting the expression of FLC (Table 3, Additional file 2) [17, 52, 53]. Also putative members of FLC repressing PRC2 complex, were present in strawberry ESTs. These include putative VIN3 (VERNALIZATION INSENSITIVE 3) [19, 20] that has been identified earlier [54], and putative SWN1 (SWINGER 1), FIE (FERTILIZATION INDEPENDENT ENDOSPERM), VRN1 (VERNALIZATION 1) and LHP1 (LIKE HETEROCHROMATIN PROTEIN 1) [19, 55, 56], which were found in this investigation (Table 3, Additional file 2). However, putative VRN2 that is needed for the repression of FLC by PRC2 was not found [19].
Table 3

The list of genes belonging to the vernalization pathway.

Gene

AT gene locus

Biological function

Act./Repr. +/-

Reference

Fragaria

E-value

FLC

AT5G10140

MADS-box TF

-

[13]

nf

 

MAF1/FLM

AT1G77080

MADS-box TF

-

[50]

nf

 

Fri complex

FRI

AT4G00650

Unknown, enhancer of FLC

-

[14]

nf

 

FRL1

AT5G16320

Unknown, enhancer of FLC

-

[15]

EX686406

4E-45

FRL2

AT1G31814

Unknown, enhancer of FLC

-

[15]

Contig 4768

6E-49

FES1

AT2G33835

CCCH zinc finger protein

-

[53]

nf

 

SUF4

AT1G30970

putative zinc finger containing TF

-

[53]

BAR-003-F06

5E-46

Swr complex

PIE

AT3G12810

ATP-dependent chromatin-remodelling factor

-

[16]

nf

 

SEF1/SWC6

AT5G37055

Component of chromatin remodelling complex

-

[52]

DY670674

4E-70

ARP6/ESD1

AT3G33520

Component of chromatin remodelling complex

-

[52]

nf

 

ATX1

AT2G31650

Putative SET domain protein

-

[90]

EX687477

4E-71

Paf1 complex

ELF7

AT1G79730

RNA polymerase 2 associated factor 1 -like

-

[17]

nf

 

ELF8

AT2G06210

RNA polymerase 2 associated factor -like

-

[17]

BAR-008-H08

3E-42

VIP4

AT5G61150

RNA polymerase 2 associated factor -like

-

[91]

EX660943

2E-50

VIP3

AT4G29830

RNA polymerase 2 associated factor -like

-

[18]

EX675781

7E-98

EFS/SDG8

AT1G77300

putative histone H3 methyltransferase

-

[53]

nf

 

VRN2-PRC2 complex

VRN2

AT4G16845

Polycomb group zinc finger

+

[92]

nf

 

CLF

AT2G23380

Polycomb group protein

+

[93]

nf

 

SWN1/EZA

AT4G02020

Polycomb group protein

+

[93]

EX687655

3E-114

FIE

AT3G20740

Polycomb group protein

+

[93]

DY671601

1E-112

VIN3

AT5G57380

PHD domain protein

+

[20]

CO816801

2E-58

LHP1

AT5G17690

epigenetic silencing

+

[56]

DY669633

2E-40

VRN1

AT3G18990

DNA binding protein

+

[55]

DY670727

8E-43

The most important genes belonging to the vernalization pathway in Arabidopsis and their biological function are presented. Floral activators and repressors are indicated by + and - marks, respectively. Moreover, the presence or absence of homologous sequence in Fragaria sequence databases and E-value of BLASTx comparison against Arabidopsis are indicated. Sequences found in our libraries are named BAR and VES for everbearing genotype 'Baron Solemacher' and short-day genotype, respectively. Other ESTs and EST contigs are found from Genome Database for Rosaceae http://www.bioinfo.wsu.edu/gdr/. More complete list is available in Additional file 2.

In addition to the photoperiod and the vernalization pathways, we searched candidate genes for the autonomous and GA pathways. Several sequences corresponding to Arabidopsis genes from both pathways were identified suggesting the presence of these pathways also in Fragaria (Table 4, Additional file 2). Among these genes we found homologs for Arabidopsis FVE and SVP which have been shown to control flowering in a specific thermosensory pathway [24, 57]. Moreover, some additional flowering time regulators that are not placed to any specific pathway were identified (Table 4, Additional file 2).
Table 4

The list of genes belonging to autonomous and gibberellin flowering pathways.

Gene

AT gene locus

Biological function

Act./Repr. +/-

Reference

Fragaria

E-value

Autonomous pathway

FCA

AT4G16280

RRM-type RNA binding domain containing

+

[94]

nf

 

FPA

AT2G43410

RRM-type RNA binding domain containing

+

[95]

nf

 

FLK

AT3G04610

KH-type RNA binding domain containing

+

[96]

EX668302

5E-52

FY

AT5G13480

mRNA 3' end processing factor

+

[97]

EX659635

5E-75

SKB1

AT4G31120

Arginine methyltransferase

+

[98]

nf

 

FVE

AT2G19520

retinoblastoma associated

+

[24]

VES-001-B03

3E-76

LD

AT4G02560

DNA/RNA binding homeodomain protein

+

[99]

DY670534

3E-49

FLD

AT3G10390

component of histone deacetylase complex

+

[23]

nf

 

LDL1/SWP1

AT1G62830

Histone H3-Lys 4 demetylase-like

+

[22]

Contig 2573

2E-27

LDL2

AT3G13682

Histone H3-Lys 4 demetylase-like

+

[22]

DY669828

1E-42

Gibberellin pathway

GAI

AT1G14920

putative transcriptional repressor

-

[100]

Contig 3276

3E-147

RGA

AT2G01570

putative transcriptional repressor

-

[100]

DQ195503

8E-60

SPY

AT3G11540

O-linked N-acetylglucosamine transferase

-

[101]

BAR-002-C02

2E-93

DDF1

AT1G12610

AP2-like TF

+

[102]

Contig 3158

5E-49

DDF2

AT1G63030

AP2-like TF

+

[102]

nf

 

AtMYB33

AT5G06100

MYB TF

+

[25]

DY669997

5E-29

FPF1

AT5G24860

Unknown

+

[103]

Contig 4074

7E-38

Other

SVP

AT2G22540

MADS-box TF

-

[57]

VES-013-D05

5E-22

AP2

AT4G36920

AP2 TF

-

[104]

VES-008-A07

9E-16

PFT1

AT1G25540

vWF-A domain protein

+

[48]

BAR-002-D08

1E-17

HRB1

AT5G49230

ZZ type zinc finger protein

+

[49]

VES-012-B01

7E-22

The most important genes of Arabidopsis autonomous and gibberellin pathways as well as some other floral regulators are presented. The biological function of the genes is indicated, and floral activators and repressors are marked by + and - marks, respectively. Moreover, the presence or absence of homologous sequence in Fragaria sequence databases and E-value of BLASTx comparison against Arabidopsis are indicated. Sequences found in our libraries are named BAR and VES for everbearing genotype 'Baron Solemacher' and short-day genotype, respectively. Other ESTs and EST contigs are found from Genome Database for Rosaceae http://www.bioinfo.wsu.edu/gdr/. More complete list is available in Additional file 2.

Identification of floral integrator genes in Fragaria

Sequencing of our EST collections did not reveal any homologs for the floral integrator or identity genes such as FT, SOC1, LFY or AP1 [12, 58]. A full-length cDNA sequence of SOC1 homolog [GenBank:FJ531999] and a 713 bp 3'-end fragment of putative LFY [GenBank:FJ532000] were isolated using PCR. Closest protein homolog of the putative FvSOC1 was 72% identical Populus trichocarpa MADS5, and the putative FvLFY showed highest amino acid identity (79%) to Malus domestica FL2. Comparison to Arabidopsis showed that AtSOC1 and AtLFY, respectively, were 66% and 75% identical with the corresponding wild strawberry protein sequences (Figure 3A and 3B). FT homolog, instead, was not identified in Fragaria despite of many attempts using degenerate PCR and screening of cDNA library plaques and E.coli clones from a variety of tissues and developmental conditions with the Arabidopsis coding sequence (K. Folta, unpublished). However, a putative FT was found in Prunus and Malus protein databases at NCBI. Among the other genes belonging to the same gene family, homologs of MFT (MOTHER OF FT AND TFL1) and ATC (ARABIDOPSIS CENTRORADIALIS) [59] were present in GDR Fragaria EST. Moreover, an EST contig corresponding to the floral identity gene AP1 was found. The length of the translated protein sequence of FvAP1 was 284 amino acids, being 30 amino acids longer than the corresponding Arabidopsis sequence. However, FvAP1 EST contig contained an unknown sequence stretch of 81 bp at nucleotide position 596-677. Putative FvAP1 showed highest overall identity (68%) with putative AP1 from Prunus persica (Figure 3C). Moreover, the 5' sequence containing 187 amino acids (the sequence before the unknown part) was 73% identical with the Arabidopsis AP1.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-9-122/MediaObjects/12870_2008_Article_464_Fig3_HTML.jpg
Figure 3

Protein alignments of Fragaria flowering integrator and identity genes. Multiple alignments of Fragaria protein sequences of full length SOC1 (A), partial LFY (B) and full-length AP1 (C) with closest protein homologs and corresponding protein sequence of Arabidopsis thaliana. Alignments were done by ClustalW (A, B) or T-Coffee (C) and modified by Boxshade program. F. vesca AP1 protein sequence was translated from GDR Fragaria EST contig 4941. PTM5 = Populus tremuloides MADS5, AFL2 = Apple FLORICAULA 2, PpAP1 = putative Prunus persica AP1.

Gene expression analysis revealed few differences between EB and SD genotypes

We compared the expression of selected flowering time genes (Table 5) corresponding to each flowering pathway in the leaf and shoot apex samples of EB and SD genotypes in order to explore the role of different pathways. Only few of the analysed genes were differentially expressed between the genotypes. Floral integrator gene LFY was slightly up-regulated in the shoot apex samples of EB (Table 6). Moreover, PCR expression analysis with two different primer pairs showed that AP1 was specifically expressed in EB apices correlating with the identity of the meristems. Among the genes from different flowering pathways, only two genes, vernalization pathway gene ELF8 [17] and photoperiod pathway gene ELF3 [60], were slightly differentially expressed between the genotypes (Table 6).
Table 5

The list of PCR primers used in real-time RT-PCR.

Gene

Forward primer

Reverse primer

UBI

CAGACCAGCAGAGGCTTATCTT

TTCTGGATATTGTAGTCTGCTAGGG

LFY

CGGCATTACGTTCACTGCTA

CCTGTAACACGCCTGCATC

SOC1

CAGGTGAGGCGGATAGAGAA

AGAGCTTTCCTCTGGGAGAGA

AP1

CGCTCCAGAAGAAGGATAAGG

CATGTGACTGAGCCTGTGCT

AP1

TCTGAAGCACGTAAGGTCTA

ATCCTGATCATAACCTCCAG

LHY

AAAGCTGGAGAAGGAGGCAGTC

CCGAGGATAAGGATTGCTTGGT

ZTL

TGCATGGGGTAGTGAAACAA

CACCTCCGACAGTGACCTTT

FKF1

ACCCACATCGTTTGTGGTCT

ACATCAGGATCCACCAGAGG

ELF3

TCCTCCAAGGAACAAGATGG

CCATTCCCCTGATTTGAGAG

ELF6

TTCGAAGGTCTTGGCAATGG

GCGCCTGAGTTTTATCCAACAC

COL4

GACCGAGAAATCCACTCTGC

CTCTCCGTCCGACAAGTAGC

CO

GACATCCACTCCGCCAAC

GTGGACCCCACCACTATCTG

PFT1

GCGACATGCCAAGGTTAGAATT

TCAGCGCCTCACACTCTTACAC

HRB1

GAATGGTGGACATCAGCAATCC

CCTCCGAAAGAATTGCTCAACA

FYPP3

ACAAAATGGCCCCTCATGTG

TGTGCTATGTGTCCATGGTGGT

FRL

CGCTAGTCAAGGTCGAGGAG

CGACTTCATCTCCATCAGCA

ELF8

GCTCAGAATGCTCCTCCTGT

TGAGTATTGCAGCCACTTGC

VRN5

AGCCCTTGATGTCATCAGCTG

CCGATGAATGGTTGGCTAATG

MSI1

TCTCCACACCTTTGATTGCCA

ACACCATCAGTCTCCTGCCAAG

LHP1

GGAGAGCCAGAACCAGGAG

CTCACCTTCTTCCCCTTCCT

FVE

GATCCAGCAGCAACCAAGTCTC

CCTCTTGGTGCAACAGAAGGAC

SVP

CGTGCTAAGGCAGATGAATGG

TGAAGCACACGGTCAAGACTTC

SPY

TGCGGTGTCAAATTGCATCA

GGCAACACTCAAGATGGATTGC

GA3ox

CCTCACAATCATCCACCAATCC

CGCCGATGTTGATCACCAA

GA2ox

CACCATGCCCAGAGCTTCA

AGGCCAGAGGTGTTGTTGGAT

TFL1

TGCAGAAACAAACGAGTTCGG

CCAAGAGCATCGATCATTTGGT

AP2

CCCGAAATCCTTGATTGTTCC

AACACTGCAATCGAACAACAGC

Tmvalue of the primers is 60 ± 1°C.

Table 6

The expression of selected genes in the wild strawberry.

Gene

MSI1as a control

FVEas a control

Shoot apex samples

  

AP1

Expressed only in EB

Expressed only in EB

LFY

1.8 ± 0.4

1.9 ± 0.3

ELF8

1.5 ± 0.1

1.6 ± 0.1

Leaf samples

  

ELF3

1.5 ± 0.1

1.8 ± 0.0

Relative gene expression in the shoot apex or leaf samples of LD grown plants of EB genotype compared to SD genotype. Ct values of genes of interest were normalized against Ctvalues of MSI1 and FVE to get normalized ΔCt values. The expression ratios between genotypes (EB/SD) were calculated from the formula 2ΔCtEB/2ΔCtSD. Values are mean ± standard deviation. Pooled shoot apex samples and leaf samples at four leaf stage were used.

Developmental regulation of floral integrator, floral identity, and GA pathway genes

We analysed the developmental regulation of AP1, LFY, SOC1, GA3ox and GA2ox transcription in the shoot apices of LD grown plants of EB and SD genotype containing one to four leaves. Ubiquitin, used as a control gene, was stable between different developmental stages, but was amplified ~1 PCR cycle earlier in SD genotype (Additional file 3). Thus direct comparison between the genotypes is not possible, but the trends during development are comparable. Three genes, AP1, LFY, and GA3ox, had clear developmental stage dependent expression pattern in EB apices, showing biggest changes after one or two leaf stage (Figure 4). The expression of AP1 was detected in EB apices already at one leaf stage, and its mRNA accumulated gradually reaching 6-fold increase at two leaf stage and 50-fold increase at four leaf stage (Figure 4A). In parallel, transcription of LFY started to increase at 2-leaf stage, but the change in its expression was much smaller (Figure 4B). A floral integrator gene, SOC1, in contrast, did not show clear developmental regulation (Figure 4C). Also GA pathway was co-regulated with AP1 and LFY, since GA biosynthetic gene GA3ox was strongly down-regulated after two leaf stage (Figure 4D). In addition, GA catabolism gene, GA2ox, tended to follow changes in the expression of GA3ox, although the results were not so clear (data not shown). In SD genotype, in contrast, AP1 was absent and other genes did not show clear developmental regulation (Figure 4). In this experiment, control plants of EB genotype flowered very early, after producing 4.7 ± 0.3 leaves to the main crown, whereas plants of SD genotype remained vegetative.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-9-122/MediaObjects/12870_2008_Article_464_Fig4_HTML.jpg
Figure 4

Developmental regulation of gene expression in wild strawberry shoot apices. The expression of AP1 (A), LFY (B), SOC1 (C) and GA3ox (D) in the SD and EB ('Baron Solemacher') genotype of the wild strawberry. Triplicate shoot apex samples were collected from LD grown plants at one to four leaf stage. Ct values were normalized against a Ubiquitin [GenBank:DY672326] gene to get normalized ΔCt values. The expression differences between one leaf stage and later developmental stages were calculated from the formula 2ΔCt later developmental stage/2ΔCt one leaf stage. The expression values at one leaf stage were artificially set to 1 separately for both genotypes. Values are mean ± SD. Note that Ubiquitin was amplified ~1 cycle earlier in SD genotype, but was stable between different developmental stages. Therefore, expression values between genotypes cannot be directly compared, while the expression levels between the various developmental stages are comparable.

Discussion

Identification of flowering genes in strawberry

Genetic regulation of flowering in strawberry has earlier been studied only by crossing experiments. According to Weebadde et al. [61], everbearing character is a polygenic trait in garden strawberry whereas other studies indicate the presence of a single dominant gene [62]. Different results may arise from different origin of everbearing habit, since at least three different sources have been used in strawberry breeding [32, 61, 62]. Studies in F. vesca 'Baron Solemacher'have shown that EB flowering habit in this genotype is controlled by recessive alleles of a single locus, called seasonal flowering locus (sfl) [40, 41]. Identification of central genes regulating flowering, as well as those controlling other processes that affect flowering (runnering, chilling), is an important goal that would greatly accelerate breeding of strawberry and other soft fruit and fruit species of Rosaceae family.

For comprehensive identification of candidate genes of the strawberry flowering pathways, we searched homologs for 118 Arabidopsis flowering time genes from our own cDNA libraries and from GDR. In total, we were able to identify 66 gene homologs among about 53000 EST sequences. Moreover, gene homologs lacking from Fragaria were further mined from Rosaceae EST collections containing about 410 000 EST sequences. These searches revealed 22 additional putative flowering time genes in Rosaceae. Ongoing genome sequencing projects in apple, peach and wild strawberry will ultimately reveal the currently lacking flowering regulators in these species [63].

Sequences found in Fragaria corresponded to all known Arabidopsis flowering time pathways [2] suggesting that all of these genetic pathways may be present in Fragaria. However, the sequence conservation does not necessarily mean functional conservation, so major candidate genes from different pathways have to be functionally characterized in order to prove the presence of these pathways in strawberry. Few central regulators of flowering time are lacking from Fragaria sequence collections and some of them also from Rosaceae databases. For example, we were not able to identify a homolog for the florigen gene FT [11] in Fragaria regardless of several different attempts. This is probably due to its low expression level and tissue specific expression pattern [64]. Similarly, GI, which links circadian clock and CO [8, 65], was absent from the Fragaria sequences. FT and GI homologs were, however, found in apple and Prunus, showing that they are present in Rosaceae. Moreover, consistent with studies in model legumes [66], CCA1 was lacking in Rosaceae, but its redundant paralog, LHY, is represented by few ESTs in Fragaria. CCA1 and LHY are MYB-type transcription factors which repress the expression of TOC1 in the central loop of Arabidopsis circadian clock [67]. Thus, in Fragaria and other species of Rosaceae family, LHY alone may control the expression of TOC1 in the clock core. This contrasts with other species, like Populus, where duplications of the LHY/CCA1 genes contribute to an apparently more complex mode of clock control [68].

Vernalization pathway in Arabidopsis culminates in FLC and FLC-like floral repressors [13, 50]. They have been functionally characterized only in Brassicaceae [13, 69], although homologous MADS box genes have been recently found from several eudicot lineages by phylogenetic analysis [51]. However, we were not able to identify FLC-like sequences in Rosaceae by using several FLC-like sequences as a query. Similarly, also FRI homologs were lacking from the Rosaceae sequence collections. However, putative homologs of FRI-like genes, FRL1 and FRL2, which are involved in FLC activation in Arabidopsis [15] were found, as well as several other homologs of genes belonging to FLC regulating protein complexes. Despite the presence of these transcripts, the presence of FLC is unclear, since at least PRC2 complex has several target genes [70]. Cloning and characterization of putative FLC-like and FRI genes as well as FT in strawberry would greatly expand our understanding of strawberry flowering pathways, and therefore, it is one of the most important targets of further studies. If these transcripts are present in strawberry, it is likely that the precise control of flowering has placed their expression in specific tissues or contexts where they are not easily detected. However, their presence should be substantiated in analysis of the impending genome sequence. Another important goal is the identification of putative Rosaceae or Fragaria specific flowering time genes. Ultimately, transcriptomics studies and functional analysis of central genes may reveal how different flowering pathways, which may be closely related to Arabidopsis pathways, make seasonal flowering in strawberry.

What is the SFLgene?

SFL is a single dominant locus that enforces seasonal flowering habit in wild strawberry, and homozygous mutation in this locus leads to continuous flowering habit in at least one genotype, 'Baron Solemacher' [36]. In SD genotypes of wild strawberry, SD or low temperature induce flowering [27] probably by overcoming the function of SFL repressor gene. We showed here that EB genotypes 'Baron Solemacher' and 'Hawaii-4' produce only 5 - 6 leaves to the main crown before the formation of the terminal inflorescence in LD at 18°C. Hence, flowering induction in these conditions occurs soon after germination. In SD (12 h) or at low temperature (11°C) instead, plants formed several leaves more before the inflorescence. This finding shows that, in contrast to SD genotypes, both SD and low temperature restrain flowering induction in these genotypes, confirming earlier suggestions that EB genotypes of wild strawberry are in fact LD plants [35]. Most simple explanation for these opposite environmental responses is that the lack of flowering inhibitor, produced by active SFL gene, unmasks LD induced flowering promotion pathway in 'Baron Solemacher' and possibly in other EB genotypes. Given that both SD and low temperature repress SFL, analogous flowering regulating pathway has not yet been characterized at molecular level.

Our gene expression analysis did not give any hints of the putative location of SFL in wild strawberry flowering pathways. However, homologs of certain flowering repressors can be consireded as candidates for SFL, including the rice CO homolog HD1 (HEADING DATE 1), or Arabidopsis vernalization pathway genes FLC and FRI [13, 14, 71]. In strawberry, the role of vernalization pathway remains unclear until the presence or absence of FRI or FLC function is confirmed or other targets for this pathway are found. Strawberry CO, instead, has been cloned and mapped in Fragaria reference map, but its position does not match with the genomic location of SFL showing that CO itself is not SFL [44, 72]. However, the possibility that some regulator of CO transcription or protein stability could be SFL cannot be ruled out and should be studied further.

Exogenously applied GA inhibits flowering in wild strawberry, and therefore, GA has been suggested to be a floral repressor [38, 39]. Similar patterns have been observed and delineate differences between recurrent and non-recurrent roses [73]. However, we did not find clear differences in the expression of GA biosynthetic and catabolism genes, GA3ox and GA2ox, in the shoot apex samples of EB and SD genotypes before the floral initiation had occurred. In contrast, GA3ox was strongly repressed in EB apices after floral initiation and GA2ox showed similar trend. The fact that these changes in GA pathway occurred after two leaf stage suggests that GA signal was regulated during early flower development rather than during floral transition. These data does not support the role of endogenous GA as the regulator of flowering induction, indicating that SFL is not situated in the GA pathway. However, quantitative analysis of GA levels is needed to show whether the observed changes in the expression of GA pathway genes are reflected at the metabolic level.

AP1is a potential marker of floral initiation in strawberry

Gene expression analysis revealed that two putative flowering genes, AP1 and LFY, were co-regulated during floral development in EB wild strawberry. The homolog of floral identity gene AP1 was expressed in the EB apex already at one leaf stage, and its expression was strongly enhanced during later developmental stages. Also LFY mRNA accumulated along with AP1 during floral development in EB genotype, whereas SOC1 did not show a clear trend. The mRNA of SOC1 and LFY were present also in SD genotype, but AP1 transcription was not detected. In Arabidopsis, LFY and AP1 activate each other's expression constituting a feedback loop [12, 58]. Moreover, AP1 is activated by FT-FD heterodimer shortly after flowering induction [10]. Thus, the expression patterns of AP1and LFY in the meristems of EB genotype suggest that flowering induction in these plants occurs before two leaf stage in LD conditions. Consistent with this conclusion, flower initials were clearly visible by stereomicroscope in the meristems at three or four leaf stage, and plants flowered after producing on average 4.7 leaves in the main crown. Based on our results, AP1 can be used as a marker for floral initiation in wild strawberry. However, functional studies are needed to confirm the role of AP1, LFY and SOC1 as floral integrator and identity genes, and this approach is currently going on.

Conclusion

We have explored putative components for the genetic flowering pathways in perennial SD plant wild strawberry by identifying 66 homologs of Arabidopsis flowering time genes. Although few central genes are lacking, these data indicate that all known genetic flowering pathways may be present in Fragaria. This is consistent with the finding that EB genotypes, 'Hawaii-4' and 'Baron Solemacher', show similar environmental regulation of flowering than Arabidopsis summer-annuals. We also studied the expression of selected candidate genes and found that few genes were co-regulated in the shoot apex of the EB genotype during early floral development. Most strikingly, the mRNA of AP1 specifically accumulated in EB genotype, but was absent in SD genotype, showing its usefulness as a marker of floral initiation. Finally, identification of putative flowering time genes reported here enables their transcriptional and functional characterization, as well as genetic mapping, which may give answers for the relative importance of each genetic flowering pathway and lead to cloning of the central repressor gene, SFL. Ultimately, these genetic resources could be utilized in cultivar breeding of various species of Rosaceae family through genetic transformation and marker assisted selection breeding.

Methods

Plant materials, growing conditions and sampling

Seeds of SD and EB ('Baron Solemacher') genotypes of the wild strawberry (NCGR accession numbers [PI551792] and [PI551507], respectively) were sown on potting soil mixture (Kekkilä, Tuusula, Finland) and grown in a greenhouse under LD conditions (day length min. 18 h), provided by 400 W SON-T lamps (Airam, Kerava, Finland) and natural sunlight. After two to three leaves had developed per plant, shoot apex samples (tip of the shoot containing the meristem as well as two to three leaf initials) were collected under a stereomicroscope at ten different time points with three days intervals. Samples from each time point were pooled and used for the construction of cDNA libraries and real-time RT-PCR. WT samples contained shoot apices of the main crown, collected from 50 plants per time point. Also in EB genotype, shoot apices of the main crown were collected until the sepal initials became visible in the meristems. After this time point, the apices from one to three side shoots per plant were collected, altogether from 40 plants per sampling. In addition, leaf samples were collected from the same plants at four leaf stage for real-time RT-PCR analysis. Moreover, separate shoot apex samples were collected from WT and EB genotypes at one, two, three and four leaf stages. Control plants were grown in LD and their flowering time was determined by counting the number of leaves in the main crown before the terminal inflorescence. All samples were collected in July - August 2006 - 2008.

Preparation and sequencing of subtracted cDNA libraries

Total RNA from pooled shoot apex samples was extracted with a pine tree method for RNA isolation [74]. The cDNA was synthesized with BD SMART cDNA Synthesis kit (Clontech, Palo Alto, US), amplified with PCR as instructed for subtraction, purified with Chroma Spin-1000 DEPC-H2O Columns (Clontech), extracted with chloroform:isoamylalcohol (24:1) using Phase Loch Gel Heavy 1.5 ml tubes (Eppendorf, Hamburg, Germany), digested with RsaI (Boehringer Mannheim, Mannheim, Germany), and purified with High Pure PCR Product Purification kit (Roche Diagnostics, Indianapolis, US). The cDNAs were subtracted using BD PCR-Select cDNA Subtraction Kit (Clontech) in both forward and reverse directions. The forward and reverse PCR mixtures were digested with RsaI (Boehringer Mannheim) and purified with High Pure PCR Product Purification Kit (Roche). After digestion, A-tailing was done as instructed in the technical manual of pGEM-T and pGEM-T Easy Vector Systems and PCR mixtures were ligated to pGEM-T Easy Vector (Promega, Wisconsis, US), and electroporated to TOP10 cells. The libraries were sequenced at the Institute of Biotechnology, University of Helsinki, as described earlier [75].

Bioinformatics analysis

Raw EST sequences were quality checked before annotation. Base calling, end clipping and vector removal were performed by CodonCodeAligner-software (CodonCode Corporation, US). After this the ESTs were manually checked and sequences that contained poly-T in the beginning followed by short repetitive sequences were removed. BLASTx was performed against functionally annotated Arabidopsis protein database (v211200, MIPS), Swissprot and non-redundant protein database (NCBI), and Populus trichocarpa genome of DOE Joint Genome Institute [76] using cut-off value 1e-10. tBLASTx was performed against TIGR plant transcript assemblies of Malus x domestica, Oryza sativa and Vitis vinifera [77], and GDR Fragaria and Rosaceae Contigs using cut-off value 1e-10. For MIPS BLAST hits corresponding functional classes and Gene Ontology classes were obtained from Functional Classification Catalogue (Version 2.1) and GO annotation for Arabidopsis thaliana (Version 1.1213).

Homologs of Arabidopsis flowering time genes were searched from GDR Fragaria contig and EST databases using tBLASTx algorithm and Arabidopsis protein sequences as a query. Homologous sequences passing a cut-off value 1e-10 were further analysed by BLASTx algorithm against Arabidopsis protein database, and sequences showing highest sequence homology with the corresponding Arabidopsis genes were selected. The sequences lacking from Fragaria were similarly searched from GDR Rosaceae EST database and from Rosaceae protein database at NCBI.

Photoperiod and temperature treatments

For the analysis of environmental regulation of flowering in EB genotypes, seeds of 'Baron Solemacher', and 'Hawaii-4' were germinated in 18 h LD at 18°C. During germination, plants were illuminated using 400 W SON-T lamps (Airam) for 12 h daily (90 ± 10 μmol m-2 s-1 at plant height plus natural light) and incandescent lamps were used for low-intensity daylength extension (5 ± 1 μmol m-2 s-1 at plant height). After opening of the cotyledons plants were moved to four treatments, SD and LD (12/18 h) at low or high temperature (11/18°C), for five weeks. In LD, incandescent lamps were used for low-intensity daylength extension (5 ± 1 μmol m-2 s-1 at plant height) after 12 h main light period. Also photoperiods of 8 and 8 + 8 h (SD/LD) were tested, but because of very slow growth in these light treatments, longer photoperiods were selected (data not shown). SD treatments were carried out at the greenhouse using darkening curtains, while LD treatments (photoperiod 18 h) were conducted in a similar greenhouse compartment without curtains. The experiments were carried out during winter 2007 - 2008, when the natural day length was under 12 h. After treatments, plants were potted to 8 x 8 cm pots, moved to LD (18 h), and flowering time was determined as described above.

Gene expression analysis

Total RNA from leaf and shoot apex samples was extracted with a pine tree method [74], and cDNAs were synthesized from total RNA using Superscript III RT kit (Invitrogen, Carlsbad, US) and dT18VN anchor primers. LightCycler 480 SYBR Green I Master kit (Roche Diagnostics, Indianapolis, US) was used to perform 15 μl real-time RT-PCR reactions in 384-well plates according to manufacturer's instructions by using Light Cycler 480 real-time PCR system (Roche Diagnostics). PCR primers with Tm value of 60°C were used (Table 5). Three biological replicates were analysed for shoot apex samples from different developmental stages (Figure 4), and two biological replicates were used for pooled shoot apex and leaf samples (Table 6).

Notes

Declarations

Acknowledgements

Dr. Michael Brosche is acknowledged for his kind help in the production of subtracted cDNA libraries and M.Sc. Techn. Erkko Airo for his valuable technical help. In addition, Finnish Ministry of Agriculture and Forestry is thanked for financial support.

Authors’ Affiliations

(1)
Department of Applied Biology, University of Helsinki
(2)
Finnish Graduate School in Plant Biology, University of Helsinki
(3)
Viikki Graduate School in Biosciences, University of Helsinki
(4)
Horticultural Sciences Department, University of Florida
(5)
Institute of Biotechnology, University of Helsinki

References

  1. Ausín I, Alonso-Blanco C, Martinez-Zapater M: Environmental regulation of flowering. Int J Dev Biol. 2005, 49: 689-705. 10.1387/ijdb.052022ia.PubMedGoogle Scholar
  2. Putterill J, Laurie R, Macknight R: It's time to flower: the genetic control of flowering time. Bioessays. 2004, 26: 363-373. 10.1002/bies.20021.PubMedGoogle Scholar
  3. Simpson GG: The autonomous pathway: epigenetic and post-transcriptional gene regulation in the control of Arabidopsis flowering time. Curr Opinion Plant Biol. 2004, 7: 570-574. 10.1016/j.pbi.2004.07.002.Google Scholar
  4. Imaizumi T, Kay SA: Photoperiodic control of flowering: not only by coincidence. Trends Plant Sci. 2006, 11: 550-558. 10.1016/j.tplants.2006.09.004.PubMedGoogle Scholar
  5. Strayer C, Oyama T, Schultz TF, Raman R, Somers DE, Más P, Panda S, Kreps JA, Kay SA: Cloning of the Arabidopsis clock gene TOC1, an autoregulatory response regulator homolog. Science. 2000, 289: 768-771. 10.1126/science.289.5480.768.PubMedGoogle Scholar
  6. Wang ZY, Tobin EM: Constitutive expression of the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) gene disrupts circadian rhytms and suppresses its own expression. Cell. 1998, 93: 1207-1217. 10.1016/S0092-8674(00)81464-6.PubMedGoogle Scholar
  7. Schaffer R, Ramsay N, Samach A, Corden S, Putterill J, Carré IA, Coupland G: The late elongated hypocotyl mutation of Arabidopsis disrupts circadian rhythms and the photoperiodic control of flowering. Cell. 1999, 93: 1219-1229. 10.1016/S0092-8674(00)81465-8.Google Scholar
  8. Suárez-López P, Wheatley K, Robson F, Onouchi H, Valverde F, Coupland G: CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature. 2001, 410: 1116-1120. 10.1038/35074138.PubMedGoogle Scholar
  9. Yanovsky MJ, Kay SA: Molecular basis of seasonal time measurement in Arabidopsis. Nature. 2002, 419: 308-312. 10.1038/nature00996.PubMedGoogle Scholar
  10. Abe M, Kobayashi Y, Yamamoto S, Daimon Y, Yamaguchi A, Ikeda Y, Ichinoki H, Notaguchi M, Goto K, Araki T: FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science. 2005, 309: 1052-1056. 10.1126/science.1115983.PubMedGoogle Scholar
  11. Corbesier L, Vincent C, Jang S, Fornara F, Fan Q, Searle I, Giakountis A, Farrona S, Gissot L, Turnbull C, Coupland G: FT protein movement contributes to long-distance signalling in floral induction of Arabidopsis. Science. 2007, 316: 1030-1033. 10.1126/science.1141752.PubMedGoogle Scholar
  12. Parcy M: Flowering: a time for integration. Int J Dev Biol. 2005, 49: 585-593. 10.1387/ijdb.041930fp.PubMedGoogle Scholar
  13. Searle I, He Y, Turck F, Vincent C, Fornara F, Krober S, Amasino RA, Coupland G: The transcription factor FLC confers a flowering response to vernalization be repressing meristem competence and systemic signalling in Arabidopsis. Genes Dev. 2006, 20: 898-912. 10.1101/gad.373506.PubMedPubMed CentralGoogle Scholar
  14. Johanson U, West J, Lister C, Michaels S, Amasino R, Dean C: Molecular analysis of FRIGIDA, a major determinant of natural variation in Arabidopsis flowering time. Science. 2000, 290: 344-347. 10.1126/science.290.5490.344.PubMedGoogle Scholar
  15. Michaels SD, Bezerra IC, Amasino RM: FRIGIDA-related genes are required for the winter-annual habit in Arabidopsis. PNAS. 2004, 101: 3281-3285. 10.1073/pnas.0306778101.PubMedPubMed CentralGoogle Scholar
  16. Noh Y, Amasino RS: PIE1, an ISWI family gene, is required for FLC activation and floral repression in Arabidopsis. Plant Cell. 2003, 15: 1671-1682. 10.1105/tpc.012161.PubMedPubMed CentralGoogle Scholar
  17. He Y, Doyle MR, Amasino RM: PAF1-complex-mediated histone methylation of FLOWERING LOCUS C chromatin is required for the vernalization-responsive, winter-annual habit in Arabidopsis. Genes Dev. 2004, 18: 2774-2784. 10.1101/gad.1244504.PubMedPubMed CentralGoogle Scholar
  18. Zhang H, Ransom C, Ludwig P, van Nocker S: Genetic analysis of early flowering mutants in Arabidopsis defines a class of pleiotropic developmental regulator required for expression of the flowering-time switch Flowering Locus C. Genetics. 2003, 164: 347-358.PubMedPubMed CentralGoogle Scholar
  19. Wood CC, Robertson M, Tanner G, Peacock WJ, Dennis ES, Helliwell CA: The Arabidopsis thaliana vernalization response requires a Polycomb-like protein complex that also includes VERNALIZATION INSENSITIVE 3. PNAS. 2006, 103: 14631-14636. 10.1073/pnas.0606385103.PubMedPubMed CentralGoogle Scholar
  20. Sung S, Amasino RM: Vernalization in Arabidopsis thaliana is mediated by the PHD finger protein VIN3. Nature. 2004, 427: 159-164. 10.1038/nature02195.PubMedGoogle Scholar
  21. Quesada V, Dean C, Simpson GG: Regulated RNA processing in the control of Arabidopsis flowering. Int J Dev Biol. 2005, 49: 773-780. 10.1387/ijdb.051995vq.PubMedGoogle Scholar
  22. Jiang D, Yang W, He Y, Amasino RM: Arabidopsis relatives of the human lysine-specific demethylase 1 repress the expression of FWA and FLOWERING LOCUS C and thus promote the floral transition. Plant Cell. 2007, 19: 2975-2987. 10.1105/tpc.107.052373.PubMedPubMed CentralGoogle Scholar
  23. He Y, Michaels SD, Amasino RM: Regulation of flowering time by histone acetylation in Arabidopsis. Science. 2003, 302: 1751-1754. 10.1126/science.1091109.PubMedGoogle Scholar
  24. Ausín I, Alonso-Blanco C, Jarillo JA, Ruiz-García L, Martínez-Zapater JM: Regulation of flowering time by FVE, a retinoblastoma-associated protein. Nat Genet. 2004, 36: 162-166. 10.1038/ng1295.PubMedGoogle Scholar
  25. Gogal GFW, Sheldon CC, Gubler F, Moritz T, Bagnall DJ, MacMillan CP, Li SF, Parish RW, Dennis ES, Weigel D, King RW: GAMYB-like genes, flowering, and gibberellin signaling in Arabidopsis. Plant Physiol. 2001, 127: 1682-1693. 10.1104/pp.010442.Google Scholar
  26. Jonkers H: On the flower formation, the dormancy and the early forcing of strawberries. In Thesis Mededelingen van de Landbouwhogeschool, Wageningen; 1965.Google Scholar
  27. Heide O, Sønsteby A: Interactions of temperature and photoperiod in the control of flowering of latitudinal and altitudinal populations of wild strawberry (Fragaria vesca). Physiol Plant. 2007, 130: 280-289. 10.1111/j.1399-3054.2007.00906.x.Google Scholar
  28. Heide O: Photoperiod and temperature interactions in growth and flowering of strawberry. Physiol Plant. 1977, 40: 21-26. 10.1111/j.1399-3054.1977.tb01486.x.Google Scholar
  29. Guttridge CG: Fragaria × ananassa. In CRC Handbook of Flowering Volume III. Edited by: Halevy A. Boca Raton: CRC Press; 1985:16-33.Google Scholar
  30. Konsin M, Voipio I, Palonen P: Influence of photoperiod and duration of short-day treatment on vegetative growth and flowering of strawberry (Fragaria × ananassa Duch.). J Hort Sci Biotech. 2001, 76: 77-82.Google Scholar
  31. Hytönen T, Palonen P, Mouhu K, Junttila O: Crown branching and cropping potential in strawberry (Fragaria × ananassa, Duch.) can be enhanced by daylength treatments. J Hort Sci Biotech. 2004, 79: 466-471.Google Scholar
  32. Darrow GM: The strawberry. History, breeding and physiology New York:Holt, Rinehart and Winston; 1966.Google Scholar
  33. Durner EF, Barden JA, Himelrick DG, Poling EB: Photoperiod and temperature effects on flower and runner development in day-neutral, junebearing and everbearing strawberries. J Amer Soc Hort Sci. 1984, 109: 396-400.Google Scholar
  34. Sønsteby A, Heide OM: Long-day control of flowering in everbearing strawberries. J Hort Sci Biotech. 2007, 82: 875-884.Google Scholar
  35. Sønsteby A, Heide OM: Long-day rather than autonomous control of flowering in the diploid everbearing strawberry Fragaria vesca ssp. semperflorens. J Hort Sci Biotech. 2008, 83: 360-366.Google Scholar
  36. Albani M, Battey NH, Wilkinson MJ: The development of ISSR-derived SCAR markers around the SEASONAL FLOWERING LOCUS (SFL) in Fragaria. Theor Appl Gen. 2004, 109: 571-579. 10.1007/s00122-004-1654-4.Google Scholar
  37. Guttridge CG: Further evidence for a growth-promoting and flower-inhibiting hormone in strawberry. Annals Bot. 1959, 23: 612-621.Google Scholar
  38. Thompson PA, Guttridge CG: Effect of gibberellic acid on the initiation of flowers and runners in the strawberry. Nature. 1959, 184: 72-73.Google Scholar
  39. Guttridge CG, Thompson PA: The effects of gibberellins on growth and flowering of Fragaria and Duchesnea. J Exp Bot. 1963, 15: 631-646. 10.1093/jxb/15.3.631.Google Scholar
  40. Brown T, Wareign PF: The genetic control of the everbearing habit and three other characters in varieties of Fragaria vesca. Euphytica. 1965, 14: 97-112.Google Scholar
  41. Battey N, Miere P, Tehranifar A, Cekic C, Taylor S, Shrives K, Hadley P, Greenland A, Darby J, Wilkinson M: Genetic and environmental control of flowering in strawberry. In Genetic and Environmental Manipulation of Horticultural Crops Edited by: Cockshull KE, Gray D,Seymour GB, Thomas B. Wallingford, UK, Cab International;1998:111-131.Google Scholar
  42. Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, Siebert PD: Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. PNAS. 1996, 93: 6025-6030. 10.1073/pnas.93.12.6025.PubMedPubMed CentralGoogle Scholar
  43. Thomas B: Light signals and flowering. J Exp Bot. 2006, 57: 3387-3393. 10.1093/jxb/erl071.PubMedGoogle Scholar
  44. Stewart P: Molecular characterization of photoperiodic flowering in strawberry (Fragaria sp.).In PhD thesis. University of Florida;2007.Google Scholar
  45. Fowler S, Lee K, Onouchi H, Samach A, Richardson K, Morris B, Coupland G, Putterill J: GIGANTEA: a circadian clock-controlled gene that regulates photoperiodic flowering in Arabidopsis and encodes a protein with several possible membrane-spanning domains. EMBO J. 1999, 18: 4679-4688. 10.1093/emboj/18.17.4679.PubMedPubMed CentralGoogle Scholar
  46. Jang S, Marchal V, Panigrahi KCS, Wenkel S, Soppe W, Deng X, Valverde F, Coupland G: Arabidopsis COP1 shapes the temporal pattern of CO accumulation conferring a photoperiodic flowering response. EMBO J. 2008, 27: 1277-1288. 10.1038/emboj.2008.68.PubMedPubMed CentralGoogle Scholar
  47. Laubinger S, Marchal V, Le Gourrierec J, Wenkel S, Adrian J, Jang S, Kulajta C, Braun H, Coupland G, Hoecker U: Arabidopsis SPA proteins regulate photoperiodic flowering and interact with floral inducer CONSTANS to regulate its stability. Development. 2006, 133: 3213-3222. 10.1242/dev.02481.PubMedGoogle Scholar
  48. Cerdán PD, Chory J: Regulation of flowering time by light quality. Nature. 2003, 423: 881-885. 10.1038/nature01636.PubMedGoogle Scholar
  49. Kang X, Zhou Y, Sun X, Ni M: HYPERSENSITIVE TO RED AND BLUE 1 and its C-terminal regulatory function control FLOWERING LOCUS T expression. Plant J. 2007, 52: 937-948. 10.1111/j.1365-313X.2007.03295.x.PubMedGoogle Scholar
  50. Scortecci KC, Michaels SD, Amasino RM: Identification of a MADS-box gene, FLOWERING LOCUS M, that repress flowering. Plant J. 2001, 26: 229-236. 10.1046/j.1365-313x.2001.01024.x.PubMedGoogle Scholar
  51. Reeves PA, He Y, Schmitz RJ, Amasino RM, Panella LW, Richards CM: Evolutionary conservation of the FLOWERING LOCUS C-mediated vernalization response: evidence from the sugar beet (Beta vulgaris). Genetics. 2007, 176: 295-307. 10.1534/genetics.106.069336.PubMedPubMed CentralGoogle Scholar
  52. Choi K, Park C, Lee J, Oh M, Noh B, Lee I: Arabidopsis homologs of components of the SWR1 complex regulate flowering and plant development. Development. 2007, 134: 1931-1941. 10.1242/dev.001891.PubMedGoogle Scholar
  53. Kim KS, Choi K, Park C, Hwanga H, Lee I: SUPPRESSOR OF FRIGIDA4, encoding a C2H2-type zinc finger protein, represses flowering by transcriptional activation of Arabidopsis FLOWERING LOCUS C. Plant Cell. 2006, 18: 2985-2998. 10.1105/tpc.106.045179.PubMedPubMed CentralGoogle Scholar
  54. Folta KM, Staton M, Stewart PJ, Jung S, Bies DH, Jesudurai C, Main D: Expressed sequence tags (ESTs) and simple sequence repeat (SSR) markers from octoploid strawberry (Fragaria × ananassa). BMC Plant Biol. 2005, 5: 12-10.1186/1471-2229-5-12.PubMedPubMed CentralGoogle Scholar
  55. Levy YY, Mesnage S, Mylne JS, Gendall AR, Dean C: Multiple roles of Arabidopsis VRN1 in vernalization and flowering time control. Science. 297: 243-246. 10.1126/science.1072147.
  56. Mylne JS, Barrett L, Tessadori F, Mesnage S, Johnson L, Bernatavichute VN, Jacobsen SE, Fransz P, Dean C: LHP1, the Arabidopsis homologue of HETEROCHROMATIN PROTEIN1, is required for epigenetic silencing of FLC. PNAS. 2006, 103: 5012-5017. 10.1073/pnas.0507427103.PubMedPubMed CentralGoogle Scholar
  57. Lee JH, Yoo SJ, Park SH, Hwang I, Lee JS, Ahn JH: Role of SVP in the control of flowering time by ambient temperature in Arabidopsis. Genes Dev. 2007, 21: 397-402. 10.1101/gad.1518407.PubMedPubMed CentralGoogle Scholar
  58. Wagner D, Sablowski RWM, Meyerowitz EM: Transcriptional activation of APETALA1 by LEAFY. Science. 1999, 285: 582-584. 10.1126/science.285.5427.582.PubMedGoogle Scholar
  59. Turck F, Fornara F, Coupland G: Regulation and identity of florigen: FLOWERING LOCUS T moves central stage. Annu Rev Plant Biol. 2008, 59: 573-594. 10.1146/annurev.arplant.59.032607.092755.PubMedGoogle Scholar
  60. Zagotta MT, Hicks KA, Jacobs CI, Young JC, Hangarter RP, Meeks-Wagner D: The Arabidopsis ELF3 gene regulates vegetative photomorphogenesis and the photoperiodic induction of flowering. Plant J. 1996, 10: 691-702. 10.1046/j.1365-313X.1996.10040691.x.PubMedGoogle Scholar
  61. Weebadde CK, Wang D, Finn CE, Lewers KS, Luby JJ, Bushakra J, Sjulin TM, Hancock JF: Using a linkage mapping approach to identify QTL for day-neutrality in the octoploid strawberry. Plant Breed. 2008, 127: 94-101.Google Scholar
  62. Ahmadi H, Bringhurst RS, Voth V: Modes of inheritance of photoperiodism in Fragaria. J Amer Soc Hort Sci. 1990, 115: 146-452.Google Scholar
  63. Shulaev V, Korban SS, Sosinski B, Abbott AG, Aldwinckle HS, Folta KM, Iezzoni A, Main D, Arús P, Dandekar AM, Lewers K, Brown SK, Davis TM, Gardiner SE, Potter D, Veilleux RE: Multiple models for Rosaceae genomics. Plant Physiol. 2008, 147: 985-1003. 10.1104/pp.107.115618.PubMedPubMed CentralGoogle Scholar
  64. Takada S, Goto K: Terminal flower 2, an Arabidopsis homolog of heterochromatin protein 1, counteracts the activation of Flowering locus T by Constans in the vascular tissues of leaves to regulate flowering time. Plant Cell. 2003, 15: 2856-2865. 10.1105/tpc.016345.PubMedPubMed CentralGoogle Scholar
  65. Sawa M, Nusinow DA, Kay SA, Imaizumi T: FKF1 and GIGANTEA complex formation is required for day-length measurement in Arabidopsis. Science. 2007, 318: 261-265. 10.1126/science.1146994.PubMedPubMed CentralGoogle Scholar
  66. Hecht V, Foucher F, Ferrandiz C, Macknight R, Navarro C, Morin J, Vardy ME, Ellis N, Beltran J, Rameau C, Weller JL: Conservation of Arabidopsis flowering genes in model legumes. Plant Physiol. 2005, 137: 1420-1434. 10.1104/pp.104.057018.PubMedPubMed CentralGoogle Scholar
  67. Alabadi D, Oyama T, Yanovsky MJ, Harmon FG, Mas P, Kay SA: Reciprocal regulation between TOC1 and LHY/CCA1 within the Arabidopsis circadian clock. Science. 2001, 293: 880-883. 10.1126/science.1061320.PubMedGoogle Scholar
  68. Böhlenius H: Control of flowering time and growth cessation in Arabidopsis and Populus trees.In PhD thesis.Swedish University of Agricultural Sciences, Umeå; 2008.Google Scholar
  69. Wang R, Farrona S, Vincent C, Joecker A, Schoof H, Turck F, Alonso-Blanco C, Coupland G, Albani MC: PEP1 regulates perennial flowering in Arabis alpina. Nature. 2009, 459: 423-427. 10.1038/nature07988.PubMedGoogle Scholar
  70. Zhang X, Clarenz O, Cokus S, Bernatavichute YV, Pellegrini M, Goodrich J, Jacobsen SE: Whole genome analysis of histone H3 lysine 27 trimethylation in Arabidopsis. PloS Biol. 2007, 5: e129-10.1371/journal.pbio.0050129.PubMedPubMed CentralGoogle Scholar
  71. Yano M, Katayose Y, Ashikari M, Yamanouchi U, Monna L, Fuse T, Baba T, Yamamoto K, Umehara Y, Nagamura Y, Sasaki T: Hd1, a major photoperiod sensitivity quantitative trait locus in rice, is closely related to the Arabidopsis flowering time gene CONSTANS. Plant Cell. 2000, 12: 2473-2484. 10.1105/tpc.12.12.2473.PubMedPubMed CentralGoogle Scholar
  72. Sargent DJ, Clarke J, Simpson DW, Tobutt KR, Arús P, Monfort A, Vilanova S, Denoyes-Rothan B, Rousseau M, Folta KM, Bassil NV, Battey NH: An enhanced microsatellite map of diploid Fragaria. Theor Appl Genet. 2006, 112: 1349-1359. 10.1007/s00122-006-0237-y.PubMedGoogle Scholar
  73. Roberts AV, Blake PS, Lewis R, Taylor JM, Dunstan DI: The effect of gibberellins on flowering in roses. J Plant Growth Regul. 1999, 18: 113-119. 10.1007/PL00007058.PubMedGoogle Scholar
  74. Monte D, Somerville S: Pine tree method for isolation of plant RNA. In DNA microarrays: a molecular cloning manual Edited by: BowtellD, Sambrook J. New York: Cold Spring Harbour Laboratory Press; 2002:124-126.Google Scholar
  75. Laitinen RAE, Immanen J, Auvinen P, Rudd S, Alatalo E, Paulin L, Ainasoja M, Kotilainen M, Koskela S, Teeri TH, Elomaa P: Analysis of the floral transcriptome uncovers new regulators of organ determination and gene families related to flower organ differentiation in Gerbera hybrida (Asteraceae). Genome Res. 2005, 15: 475-486. 10.1101/gr.3043705.PubMedPubMed CentralGoogle Scholar
  76. Tuskan GA, DiFazio S, Jansson S, Bohlmann J, Grigoriev I, et al: The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science. 2006, 313: 1596-1604. 10.1126/science.1128691.PubMedGoogle Scholar
  77. Childs KL, Hamilton JP, Zhu W, Ly E, Cheung F, Wu H, Rabinowicz PD, Town CD, Buell CR, Chan AP: The TIGR plant transcript assemblies database. Nucleic Acids Res. 2007, 35: D846-D851. 10.1093/nar/gkl785.PubMedPubMed CentralGoogle Scholar
  78. Mockler T, Yang H, Yu X, Parikh D, Cheng Y, Dolan S, Lin C: Regulation of photoperiodic flowering by Arabidopsis photoreceptors. PNAS. 2003, 100: 2140-2145. 10.1073/pnas.0437826100.PubMedPubMed CentralGoogle Scholar
  79. Guo HW, Yang WY, Mockler TC, Lin CT: Regulation of flowering time by Arabidopsis photoreceptors. Science. 1998, 279: 1360-1363. 10.1126/science.279.5355.1360.PubMedGoogle Scholar
  80. Kim W, Fujiwara S, Suh S, Kim J, Kim Y, Han L, David K, Putterill J, Nam HG, Somers DE: ZEITLUPE is a circadian photoreceptor stabilized by GIGANTEA in blue light. Nature. 2007, 449: 356-360. 10.1038/nature06132.PubMedGoogle Scholar
  81. Kim D, Kang J, Yang S, Chung K, Song P, Park C: A phytochrome-associated protein phosphatase 2A modulates light signals in flowering time control in Arabidopsis. Plant Cell. 2002, 14: 3043-3056. 10.1105/tpc.005306.PubMedPubMed CentralGoogle Scholar
  82. Staiger D, Allenbach L, Salathia N, Fiechter V, Davis SJ, Millar AC, Chory J, Fankhauser C: The Arabidopsis SRR1 gene mediates phyB signaling and is required for normal circadian clock function. Genes Dev. 2003, 17: 256-268. 10.1101/gad.244103.PubMedPubMed CentralGoogle Scholar
  83. Hazen SP, Schultz TF, Pruneda-Paz JL, Borevitz JO, Ecker JR, Kay SA: LUX ARRHYTHMO encodes a myb domain protein essential for circadian rhythms. PNAS. 2005, 102: 10387-10392. 10.1073/pnas.0503029102.PubMedPubMed CentralGoogle Scholar
  84. Doyle MR, Davis SJ, Bestow RM, McWatters HG, Kozma-Bognar L, Nagy F, Millar AJ, Amasino MR: The ELF4 gene controls circadian rhythms and flowering time in Arabidopsis thaliana. Nature. 2002, 419: 74-77. 10.1038/nature00954.PubMedGoogle Scholar
  85. Nakamichi N, Kita M, Niinuma K, Ito S, Yamashino T, Mizoguchi T, Mizuno T: Arabidopsis clock-associated pseudo-response regulators PRR9, PRR7 and PRR5 coordinately and positively regulate flowering time through the canonical CONSTANS-dependent photoperiodic pathway. Plant Cell Physiol. 2007, 48: 822-832. 10.1093/pcp/pcm056.PubMedGoogle Scholar
  86. Noh B, Lee S, Kim H, Yi G, Shin E, Lee M, Jung KMR, Doyle KMR, Amasino RM, Noh Y: Divergent roles of a pair of homologous jumonji/zinc-finger-class transcription factor proteins in the regulation of Arabidopsis flowering time. Plant Cell. 16: 2601-2613. 10.1105/tpc.104.025353.
  87. Hanzawa Y, Money T, Bradley D: A single amino acid converts a repressor to an activator of flowering. PNAS. 2005, 102: 7748-7753. 10.1073/pnas.0500932102.PubMedPubMed CentralGoogle Scholar
  88. Chen M, Ni M: RFI2, a RING-domain zinc finger protein, negatively regulates CONSTANS expression and photoperiodic flowering. Plant J. 2006, 46: 823-833. 10.1111/j.1365-313X.2006.02740.x.PubMedGoogle Scholar
  89. Cai X, Ballif J, Endo S, Davis E, Liang M, Chen D, DeWald D, Kreps J, Zhu T, Wu Y: A putative CCAAT-binding transcription factor is a regulator of flowering timing in Arabidopsis. Plant Physiol. 2007, 145: 98-105. 10.1104/pp.107.102079.PubMedPubMed CentralGoogle Scholar
  90. Pien S, Fleury DF, Mylne JS, Crevillen P, Inzé D, Avramova Z, Dean C, Grossniklaus U: ARABIDOPSIS THITHORAX1 dynamically regulates FLOWERING LOCUS C activation via histone 3 lysine 4 trimethylation. Plant Cell. 2008, 20: 580-588. 10.1105/tpc.108.058172.PubMedPubMed CentralGoogle Scholar
  91. Zhang H, van Nocker S: The VERNALIZATION INDEPENDENCE 4 gene encodes a novel regulator of FLOWERING LOCUS C. Plant J. 2002, 31: 663-673. 10.1046/j.1365-313X.2002.01380.x.PubMedGoogle Scholar
  92. Gendall AR, Levy YY, Wilson A, Dean C: The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization in Arabidopsis. Cell. 2001, 107: 525-535. 10.1016/S0092-8674(01)00573-6.PubMedGoogle Scholar
  93. Chanvivattana Y, Bishopp A, Schubert D, Stock C, Moon Y, Sung ZR, Goodrich J: Interaction of Polycomb-group proteins controlling flowering in Arabidopsis. Development. 2004, 131: 5263-5276. 10.1242/dev.01400.PubMedGoogle Scholar
  94. MacKnight R, Bancroft I, Page T, Lister C, Schmidt R, Love K, Westphal L, Murphy G, Sherson S, Cobbett C, Dean C: FCA, a gene controlling flowering time in Arabidopsis thaliana encodes a protein containing RNA binding domains. Cell. 1997, 89: 737-745. 10.1016/S0092-8674(00)80256-1.PubMedGoogle Scholar
  95. Schomburg FM, Patton DA, Meinke DW, Amasino RM: FPA, a gene involved in floral induction in Arabidopsis thaliana, encodes a protein containing RNA-recognition motifs. Plant Cell. 2001, 13: 1427-1436. 10.1105/tpc.13.6.1427.PubMedPubMed CentralGoogle Scholar
  96. Lim MH, Kim J, Kim YS, Chung KS, Seo YH, Lee I, Kim J, Hong CB, Kim HJ, Park CM: A new Arabidopsis thaliana gene, FLK, encodes a RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 2004, 16: 731-740. 10.1105/tpc.019331.PubMedPubMed CentralGoogle Scholar
  97. Simpson GG, Dijkwel PP, Quesada V, Henderson I, Dean C: FY is a RNA 3'end-processing factor that interacts with FCA to control the Arabidopsis thaliana floral transition. Cell. 2003, 113: 777-787. 10.1016/S0092-8674(03)00425-2.PubMedGoogle Scholar
  98. Wang X, Zhang Y, Ma Q, Zhang Z, Xue Y, Bao S, Chong K: SKB1-mediated symmetric dimethylation of histone H4R3 controls flowering time in Arabidopsis. EMBO J. 2007, 26: 1934-1941. 10.1038/sj.emboj.7601647.PubMedPubMed CentralGoogle Scholar
  99. Lee I, Aukerman MJ, Gore SL, Lohman KN, Michaels SD, Weaver LM, John MC, Feldmann KA, Amasino RM: Isolation of LUMINIDEPENDENS: a gene involved in the control of flowering time in Arabidopsis thaliana. Plant Cell. 1994, 6: 75-83. 10.1105/tpc.6.1.75.PubMedPubMed CentralGoogle Scholar
  100. Cheng H, Qin L, Lee S, Fu X, Richards DE, Cao D, Luo D, Harberd NP, Peng J: Gibberellin regulates Arabidopsis floral development via suppression of DELLA protein function. Development. 2004, 131: 1055-1064. 10.1242/dev.00992.PubMedGoogle Scholar
  101. Tseng TS, Salomé PA, McClung CR, Olszewski NE: SPINDLY and GIGANTEA interact and act in Arabidopsis thaliana pathways involved in light responses, flowering and rhythms in leaf movements. Plant Cell. 2004, 16: 1550-1563. 10.1105/tpc.019224.PubMedPubMed CentralGoogle Scholar
  102. Magome H, Yamaguchi S, Hanada A, Kamiya Y, Oda K: Dwarf and delayed-flowering 1, a novel Arabidopsis mutant deficient in gibberellin biosynthesis because of overexpression of putative AP2 transcription factor. Plant J. 2004, 37: 720-729. 10.1111/j.1365-313X.2003.01998.x.PubMedGoogle Scholar
  103. Kania T, Russenberger D, Peng S, Apel K, Melzer S: FPF1 promotes flowering in Arabidopsis. Plant Cell. 1997, 9: 1327-1338. 10.1105/tpc.9.8.1327.PubMedPubMed CentralGoogle Scholar
  104. Aukerman MJ, Sakai H: Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes. Plant Cell. 2003, 15: 2730-2741. 10.1105/tpc.016238.PubMedPubMed CentralGoogle Scholar

Copyright

© Mouhu et al; licensee BioMed Central Ltd. 2009

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement