Open Access

Synteny conservation between two distantly-related Rosaceae genomes: Prunus (the stone fruits) and Fragaria(the strawberry)

  • Santiago Vilanova1, 3,
  • Daniel J Sargent2,
  • Pere Arús1 and
  • Amparo Monfort1Email author
BMC Plant Biology20088:67

DOI: 10.1186/1471-2229-8-67

Received: 31 October 2007

Accepted: 18 June 2008

Published: 18 June 2008

Abstract

Background

The Rosaceae encompass a large number of economically-important diploid and polyploid fruit and ornamental species in many different genera. The basic chromosome numbers of these genera are x = 7, 8 and 9 and all have compact and relatively similar genome sizes. Comparative mapping between distantly-related genera has been performed to a limited extent in the Rosaceae including a comparison between Malus (subfamily Maloideae) and Prunus (subfamily Prunoideae); however no data has been published to date comparing Malus or Prunus to a member of the subfamily Rosoideae. In this paper we compare the genome of Fragaria, a member of the Rosoideae, to Prunus, a member of the Prunoideae.

Results

The diploid genomes of Prunus (2n = 2x = 16) and Fragaria (2n = 2x = 14) were compared through the mapping of 71 anchor markers – 40 restriction fragment length polymorphisms (RFLPs), 29 indels or single nucleotide polymorphisms (SNPs) derived from expressed sequence tags (ESTs) and two simple-sequence repeats (SSRs) – on the reference maps of both genera. These markers provided good coverage of the Prunus (78%) and Fragaria (78%) genomes, with maximum gaps and average densities of 22 cM and 7.3 cM/marker in Prunus and 32 cM and 8.0 cM/marker in Fragaria.

Conclusion

Our results indicate a clear pattern of synteny, with most markers of each chromosome of one of these species mapping to one or two chromosomes of the other. A large number of rearrangements (36), most of which produced by inversions (27) and the rest (9) by translocations or fission/fusion events could also be inferred. We have provided the first framework for the comparison of the position of genes or DNA sequences of these two economically valuable and yet distantly-related genera of the Rosaceae.

Background

Genome comparisons based on the map position of homologous markers between different plant taxa have established that the genomes of species within families of the Plant Kingdom, such as Solanaceae [1, 2], Poaceae [3], Fabaceae [4] and Brassicaceae [5] differ in a limited number of chromosomal rearrangements, meaning that extensive chromosomal regions, and even entire chromosomes, are syntenic and colinear between different species [6]. However, conservation of synteny is greatly reduced when comparisons are made between members of different families, as shown through the comparison of the genomes of several crop species with that of Arabidopsis thaliana [79].

The Rosaceae encompass a large number (3,000) of diploid and polyploid species [10] including important crops, such as those belonging to the genera Prunus (almond and all stone fruits: peach, apricot, cherry and plum), Malus (apple), Pyrus (pear), Rosa (rose), Rubus (raspberry) and Fragaria (strawberry). Their basic chromosome numbers are x = 7, 8 and 9 and all have a compact and relatively similar genome size that for diploid species ranges from ~170 Mbp in Fragaria (2n = 2x = 14) [11] to ~300 Mbp in Prunus (2n = 2x = 16) [12]. Most of the polyploid species within the family have a genome size approximately proportional to that of the diploid genomes from which they are composed, i.e. the amphidiploid apple (2n = 2x = 34) has a genome size of ~750 Mbp [12] and the cultivated strawberry, an allo-octoploid (2n = 8x = 56), has a genome size of ~800 Mbp [11].

Comparative mapping has been performed to a limited extent in the Rosaceae [13]. The genus Prunus, from the subfamily Prunoideae, was the first to be studied, due to the existence of a high density reference map [14, 15], based on a highly polymorphic interspecific (almond × peach) F2 population and constructed with markers transferable to other species within the genus (mainly RFLPs and SSRs). The analysis of 16 published maps of Prunus species, each with at least 28 markers common to the reference map, established that the Prunus genome is essentially colinear and shared by all diploid species studied so far (peach, almond, apricot, cherry, myrobolan plum, P. davidiana, and P. ferganenesis) [13]. Comparisons between the genomes of apple and pear, which belong to the subfamily Maloideae, indicate a very high level of synteny, and no major chromosomal rearrangements can be deduced from studies of common markers mapped in these genera [16, 17]. No data are currently published on synteny studies between members of the subfamily Rosoideae, which includes strawberry, rose and raspberry. There is however a partial comparison between the genomes of genera belonging to different sub-families: Prunus (Prunoideae) and Malus (Maloideae). This work was done with 34 markers (23 RFLPs and 11 isoenzymes) and, where comparisons were possible, a high level of synteny was detected, as well as at least one large-scale chromosomal rearrangement [14].

In this paper we have compared the genomes of Prunus and Fragaria. For this purpose, we have used the previously mentioned Prunus reference map and the Fragaria reference map [18], which is based on an interspecific diploid F. vesca × F. nubicola F2 population. The Fragaria map was constructed with mainly SSRs and markers derived from the growing information existing on expressed sequence tag (EST) sequences of different Rosaceae species, which are available through the Genome Database for the Rosaceae [19]. Here, we have established a framework with common markers covering both genomes and found that in spite of the conservation of large chromosomal fragments, as expected from confamilial species, many chromosomal rearrangements separate the diploid Fragaria and Prunus genomes, supporting their distant position within the family deduced from DNA sequence data [20].

Results

Fragaria and Prunus maps

In total, 71 anchor markers were available for the comparison between the diploid genomes of Prunus and Fragaria. These were: a) 40 RFLPs from the same number of probes found polymorphic out of 65 single-copy probes already mapped in Prunus (Table 1), b) 13 Fragaria ESTs obtained after selecting from 135 of them highly homologous to Prunus mapped ESTs out of the 515 ESTs of the Prunus transcript map (Table 2); these markers were selected by their position on the map as they fell in regions not covered with RFLPs or that were judged to be of interest for the genome comparison, c) eight Prunus ESTs selected from 13 ESTs of the transcript map that did not have sequence homology with known Fragaria ESTs (Table 2), d) eight Fragaria STSs obtained from genes of known function previously mapped in Fragaria [21] (Table 2), and e) two SSRs (Table 2).
Table 1

RFLP probes mapped in Prunus and Fragaria Single-copy RFLP probes mapped in Prunus and used for mapping in Fragaria. RFLP position in the Prunus and Fragaria maps and estimated copy number in Fragaria

  

Prunus

Fragaria

 

Marker

Accession No.

LGa

cM

LGa

cM

Copy no.

AG53

BH023829

PG1

2.5

FG4

22.1

2

AC24

BI203138

PG1

4.3

FG4

20.3

1

AG102

BH023845

PG1

8.7

FG6

63.4

2

PC78

BI203148

PG1

13.6

FG4

31.1

1

AC32

BI203135

PG1

25.8

FG4

0

2

FG16

BH023876

PG1

37

+c

-

-

PC85

n.d.b

PG1

37

+

-

-

PC15

BI203140

PG1

43

+

-

-

AG47

BH023861

PG1

43.7

FG2

17.4

2

PC7

n.d.

PG1

44

++d

-

-

FG36

BH023883

PG1

65.1

FG2

36.8

1

AC13

BI203106

PG2

6

+

-

-

AC31

BI203096

PG2

7.9

FG7

0

1

AC10

BI203087

PG2

8.1

FG4

13.5

2

PC5

BI203107

PG2

21

+

-

-

AG35

BH023896

PG2

25

FG7

9

1

AC19

BI203097

PG2

37

++

-

-

MC045

BI203117

PG2

38

FG7

81

2

Ole1

X78118

PG2

39

+

-

-

Omt1

X83217

PG2

47.6

FG7

89.6

1

CC125

n.d.

PG2

49

+

-

-

MC115

n.d.

PG3

0

++

-

-

FG13

n.d.

PG3

6

++

-

-

AG56

n.d.

PG3

6.4

FG6

65.2

1

AG7

BH023839

PG3

12

+

-

-

CC116

n.d.

PG3

22

FG6

4.7

1

CC2

BI203070

PG3

27.7

FG6

43.7

2

CC8

BI203091

PG3

34.4

FG6

81.9

1

AG106

BH023814

PG3

37.1

FG6

96

2

CC47

BI203119

PG4

5.4

FG3

7.3

1

AG6

BH023828

PG4

24.1

FG3

42.2

1

FG3

BH023837

PG4

37.7

FG3

36.5

1

PC1

BI203133

PG4

49.9

FG3

48.2

1

PLG35

n.d.

PG5

0

me

-

-

AC49

BI203072

PG5

15.2

FG5

0

1

PC14

BI203132

PG5

20.6

FG5

19.1

1

AG33

BH023821

PG5

49.1

FG5

56.4

1

AG13

n.d.

PG6

3

+

-

-

AG54

n.d.

PG6

3

+

-

-

AG40

BH023810

PG6

5

+

-

-

PLG59

n.d.

PG6

5

+

-

-

FG215

BH023827

PG6

8.7

FG3

36.5

1

AC50

BI203094

PG6

17.5

FG3

48.2

2

AC8

BI203052

PG6

34.5

FG1

61.2

2

PC21

n.d.

PG6

56.4

FG1

72.8

2

PC73

n.d.

PG6

64

m

-

-

PC60

n.d.

PG6

70

+

-

-

Pgl1

X75020

PG6

74.3

FG6

22.8

1

LTP2

n.d.

PG6

78

+

-

-

AC44

BI203095

PG7

10.3

FG2

77.1

2

PC12

n.d.

PG7

24.7

FG6

102.7

1

MC225

BI203059

PG7

28.4

FG6

61.5

1

AG104

BH023923

PG7

31.2

FG6

57

1

TSA3

n.d.

PG7

52.9

FG1

39.3

1

FG42

n.d.

PG7

59

m

-

-

FG27

BH023875

PG7

63

+

-

-

CC132

BI203120

PG7

67.6

FG3

38.3

2

FG24

BH023858

PG7

80

++

-

-

EXT1

n.d.

PG8

4

++

-

-

LY29

BH023873

PG8

20.8

FG2

19.5

2

PC101

BI203099

PG8

29.3

FG2

19.7

1

FG37

BH023891

PG8

40.9

FG2

25.3

1

AG49

BH023870

PG8

49.1

FG6

61.5

1

AC26

BI203074

PG8

52

++

-

-

Pru1

X78119

PG8

53.1

FG2

26.7

1

PC36

n.d.

PG8

60

+

-

-

aLG = Linkage group in Fragaria (F) and Prunus (P)

bn.d. = not determined

c+ = no or weak hybridization

d++ = complex banding pattern

em = monomorphic

Table 2

Gene and EST-based markers mapped in Prunus and Fragaria.

 

Prunus

Fragaria

TBLASTX

Locus

Accession number

LGa

cMb

Accession number

LGa

cMb

E-valuec

Swissprot-homologyd

Markere

EFvVB2119

BU048565

PG1

4.3

CX662119

FG6

22.5–43.2

5,00E-49

small GTP binding protein

SNP

EFvVB2179

BU046414

PG1

4.3

CX662179

FG4

0.0–26.0

2,00E-78

Aldoketo-reductase

SNP

EFvNH8894

BU042720

PG1

40.5

DV438894

FG2

53.9–73.8

3.00E-84

auxin-induced protein (Aux22)

SNP

EFaUF6868

BU046817

PG1

48.0

CO816868

FG2

53.9–73.8

1.00E-109

20S proteasome alpha 6 subunit

Indel

EFaTR1976

BU039761

PG1

48.6

CO381976

FG2

53.9–73.8

2.00E-88

Mannan endo-1.4-Beta-Mannosidase

SNP

EKO

AF495728

PG1

35.7–49.8

AY462247

FG2

28.9

8.00E-155

Ent-kaurene oxidase

Indel

DFR

AB095030

PG1

35.7–49.8

AY575057

FG2

70.5

2.00E-106

dihydroflavonol reductase

Indel

EFvVB1231

BU046687

PG1

41.3

CX661231

FG4

26.0–46.1

5.00E-17

RAD23-like

SNP

EPpCU7308

BU047308

PG1

75.2

-

FG2

26.7–45.8

5.00E-27

electron carrier/iron ion binding

Indel

EPpCU9642

BU039642

PG1

40.5

-

FG2

0.0–26.7

4.00E-72

ACT domain-containing protein

Indel

EFaUF7699

BU040484

PG2

7.9

CO817699

FG4

0.0–26.0

1.00E-102

Luminal Binding Protein BiP

Indel

EFaUF7084

BU046792

PG2

24.3

CO817084

FG7

63.4–81.0

3.00E-96

40 S ribosomal protein

SNP

EPpCU2875

BU042875

PG2

25.0

-

FG7

20.3

4.00E-132

RNA helicase

Indel

EFvNH8484

BU041902

PG2

39.4

DV438484

FG7

27.0–38.6

5.00E-105

GTP-Binding protein

SNP

EPpCU9223

BU039223

PG2

39.4

DY672045

FG7

44.5

1.00E-48

6-phosphofructokinase

Indel

ACO

AF129073

PG3

35.0

AY706156

FG6

83.1

1.00E-165

ACC oxydase

SSR

EFvVB2013

BU039972

PG5

0.0

CX662013

FG5

50.4–72.5

6.00E-83

Pectinacetylesterase precursor

Indel

ANS

AB097216

PG5

15.2–21.0

AY695818

FG5

9.7

4.00E-143

Anthocyanidin shynthase

Indel

CEL-2

AJ890498

PG5

21.7–40.7

AF054615

FG5

29.2

0.0

endo-beta-1,4-glucanase

Indel

AMPA112

AY377916

PG5

4.1

-

FG5

64.5

-

--

SSR

EFvNH9852

BU040757

PG6

6.4

DV439852

FG7

27.0–38.6

1.00E-137

60S Ribosomal Protein L10

SNP

EPpCU9257

BU039257

PG6

17.5

-

FG7

24.9

7.00E-109

phosphoglucomutase precursor

Indel

EPpCU1785

BU041785

PG6

79.6

DY669394

FG1

45.2–47.9

1.00E-12

SNF4 (Sucrose NonFermenting 4)

SNP

EPpCU1830

BU041830

PG6

79.6

CX661290

FG6

14.1

1.00E-132

26s proteasome aaa-atpase subunit rpt5a

Indel

APX

EE488129

PG6

4.1–24.9

AF158654

FG3

49.5

4.00E-102

L-ascorbate peroxidase

Indel

EFaUF7248

BU043308

PG7

10.3

CO817248

FG2

53.9–73.8

1.00E-97

Methionine synthase

Indel

EFvVB1923

BU039764

PG7

29.6

CX661923

FG6

56.5–68.1

2.00E-73

Enolase

SNP

EPpCU9910

BU039910

PG7

64.7

-

FG1

8.3

1.00E-62

putative ethanolamine kinase 1

Indel

F3H

AB097151

PG7

42.5–47.8

AB201760

FG1

40.6

2.00E-178

flavanone 3-hydroxylase

Indel

PES

X95991

PG7

49–56.1

AY324809

FG1

33.7

0.0

Pectinesterase

Indel

ADH

BU573880

PG8

0.0–10.9

X15588

FG2

17.9

4.00E-101

alcohol dehydrogenase

SNP

Gene or EST-based and SSR markers mapped in the Prunus and Fragaria genomes, with their accession numbers, map positions and homology with known proteins of other species.

a LG = linkage group

b Map position: If the marker was bin-mapped, the interval covered by the bin where the marker is located

c E-value at NCBI database restricted to plant sequences

d Predicted function

e Marker type detected

Two mapping strategies were used in the placement of novel markers on both the T×E and FV×FN linkage maps (Table 3). For 55 markers: all 40 RFLPs, the eight Fragaria STSs, five of the Fragaria ESTs that displayed intron length polymorphisms and the two SSRs, were mapped by genotyping all individuals of the FV×FN population. The 16 remaining markers were mapped using the bin mapping approach where a set of six plants (the bin set) permit wselective' or 'bin' mapping using the diploid strawberry mapping population [22]. Only ten new markers were mapped in the T×E population: the eight Fragaria ESTs were bin mapped [15] and the two SSRs were mapped using the whole population.
Table 3

Anchor markers used for map comparison.

Markers

Prunus (T×E)

Fragaria (FV×FN)

No. anchor markers

RFLPs

Mapped by Dirlewanger et al. (2004)

Mappeda

40

Fragaria ESTs

Mapped in the transcript map (GDR)

Bin mappeda

13

Fragaria ESTs

Bin mappeda

Mapped by Sargent et al. (2007)

8

Prunus ESTs

Mapped in the transcript map (GDR)

Bin mapped (3)a or mapped (5)a

8

Microsatellites

Mappeda

Mapped (1) by Sargent et al. (2007) or here (1)a

2

Origin of the 71 anchor markers used for the comparison between the genomes of Prunus and diploid Fragaria using the reference populations (T×E for Prunus and FV×FN for Fragaria) and mapping strategies used: with the whole population ("mapped") or by bin mapping ("bin mapped").

aResults obtained in this paper

The Fragaria map, constructed with MapMaker as described in the materials and methods, included 228 markers: 172 of the previous map [18], and 55 new markers studied here in the whole population. Three of the markers mapped in the map by Sargent et al. [18], CFVCT028, CFVCT05 and UFFxa03B05, could not be located using the conditions set for mapping in this work. The seven expected linkage groups (FG1–FG7) were detected, and the total genetic distance covered by the FV×FN map was of 568.8 cM with an average density of 2.5 cM/marker and a ratio of 0.30 Mb/cM. The resulting map shows minor rearrangements in comparison to the original obtained by Sargent et al. [18] most of which occurred in the upper part of the FG2. This map is presented in Additional file 1: 'FV×FN reference map' that is included as supplementary information. The Prunus map included a total of 564 markers, the 562 described in [14] plus two SSRs mapped here. The map covers a distance of 511,3 cM with an average density of 0.91 cM/marker and a ratio of 0.59 Mb/cM.

The distribution of the 71 anchor markers across the seven linkage groups of the strawberry genome was relatively even (Figure 1), ranging from seven markers on FG1 and FG5 to sixteen markers on FG2, with average marker densities ranging from 10.6 cM/marker on FG1 to 5.5 on FG2. The map distance covered by these markers was 441.3 cM, a 78% of the map constructed with all markers. Only three large gaps of >30 cM were observed, one at the end of FG3 (32.0 cM), one in the middle of FG2 (31.7 cM) and the longest on the lower part of FG7 (37.2 cM). The distribution of these 71 markers across the Prunus map was similar, with a maximum of 17 markers on PG1 and a minimum of four on PG4 and marker densities per linkage group ranging from 15.6 (PG4) to 5.0 (PG2) cM/marker. Map coverage with anchor markers was of 399.5 cM, a 78% of the complete map. Longest gaps between markers were smaller in Prunus, with only four exceeding 20 cM: 21.7 on PG7; 21.9 on PG6, 20.8 on PG8 and 28.6 on PG5. All the gaps on both the Fragaria and Prunus maps had at least one marker bin-mapped between the extreme markers of the gap, except for those on PG6 and FG3, suggesting that these were the longest gaps of each map.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-8-67/MediaObjects/12870_2007_Article_275_Fig1_HTML.jpg
Figure 1

Prunus-Fragaria map comparisons. Comparison between the maps of diploid Fragaria (FG1 to FG7) and Prunus (PG1 to PG8). Only common markers have been included in the framework of the reference maps of both genera. In parentheses after the markers is the distance from the origin of the linkage group to the marker for markers that have been mapped using the whole Prunus or Fragaria population. RFLP names are written in black and EST-derived markers in grey. The distance from the origin is not shown for markers that were bin-mapped, which are located within the region of the bin, indicated by a solid vertical bar at the corresponding locations on each of the linkage groups. Markers of one linkage group with correspondence in the other genome to linkage groups other than those that are in the neighbourhood have been indicated by the name of the corresponding group in parenthesis.

Map comparison between Prunus and Fragaria

The overall pattern of synteny is summarized in Figure 2, where it can be seen that the majority of linkage groups of either species have most markers in one or two linkage groups of the other. The simplest case is G5 of both species which have all markers in common, and the most complex is FG6 which contains markers from five different Prunus linkage groups, although most of the markers on this linkage group belong to PG3 and PG7. Considering only the Prunus linkage groups, five of them contain most or all markers from only one group of Fragaria (PG2-FG7, PG3-FG6, PG4-FG3, PG5-FG5 and PG8-FG2), and the other three of two groups (PG1-FG2 and FG4, PG6-FG1 and FG3, and PG7-FG1 and FG6).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-8-67/MediaObjects/12870_2007_Article_275_Fig2_HTML.jpg
Figure 2

Prunus-Fragaria synteny comparison. Synteny between Prunus and Fragaria. Number of markers of each linkage group of one genus that correspond to the linkage groups in the other genus. Each marker is indicated by a black dot. Cells that contain three or more markers are noted with a grey background.

The presence of markers from two or more linkage groups of one species in a linkage group of the other would suggest that a fission/fusion, or a translocation event has taken place between the two species since their divergence from a common ancestor. Nine of these rearrangements would have taken place between the Fragaria and the Prunus genomes, based on our results.

Colinearity of markers within syntenic regions of Prunus and Fragaria was only partial. The two most colinear groups FG5 and PG5 require only one inversion event to place all markers in the same order, but many more are required in other linkage groups. As shown in the materials and methods section, FG1 would require two inversions for the markers present on that linkage group to be in the same order as on PG7 and PG6 of Prunus, FG3 and FG4, three inversions, FG7 four inversions, FG6 six inversions and FG2 eight inversions. In total, at least 27 inversions are needed to account for the differences in the marker order of the two genomes. The estimated lower boundary of the total number of breakpoints that separate the Fragaria and Prunus genomes is thus 36 (nine translocations and 27 inversions).

A scheme of the possible evolution of the Fragaria and Prunus genomes from a hypothetical ancestral genome of x = 9 [23] is presented in Figure 3. In this scheme we have only considered the major chromosomal rearrangements, i.e. fusions/fissions and reciprocal translocations involving more than two of the markers used for the comparison. According to this scenario, the ancestral genome underwent two fusions (A5/A6 and A7/A8, corresponding to FG6 and FG1, respectively) and a reciprocal translocation between part of the A8 chromosome in FG1 and A9, which resulted in FG3, to become the x = 7 strawberry genome. For the Prunus x = 8 genome, the ancestral genome was submitted to three fusions, A1/A2 to form PG1, A6/A7 to form PG7 and A8/A9 to form PG6 and two fissions, part of A1 in the A1/A2 chromosome to form PG8 and part of A9 in the A8/A9 chromosome to form PG4.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-8-67/MediaObjects/12870_2007_Article_275_Fig3_HTML.jpg
Figure 3

Scheme of the evolution of Prunus and Fragaria chromosomes from an ancestral genome. Model of evolution of Prunus (PG1–PG8) and Fragaria (FG1–FG7) chromosomes from a hypothetical ancestral Rosaceae genome with x = 9 chromosomes (A1–A9). Only major chromosomal rearrangements (fusion/fission or translocation events involving more than two common markers between the two genomes) have been considered.

Some inferences about the evolution of certain chromosomes can be formulated based on the comparison between the two maps (Figure 1), the proposed evolution of both genomes from an ancestral one (Figure 3), and the limited information available on cytogenetics and map comparison of the Rosaceae. The simplest comparison is that of FG5 and PG5, which display remarkable levels of structural conservation, the marker order between Prunus and Fragaria differing by just a single inversion event. Most markers of FG7 and PG2 are in common, suggesting their origin from a single ancestral chromosome (A4), but FG7 includes a short fragment of PG6, and PG2 is not completely included in FG7, with a small region being located on FG4. PG1 is a long linkage group that contains many more markers than the rest and that is likely to coincide with chromosome 1 of Prunus [14], which is clearly longer than the other chromosomes of this genus [24]. Based on karyotype observations, such a long chromosome does not exist in Malus [25] or in Fragaria [26]. The map comparison between Malus and Prunus [14] provided additional evidence that the long Prunus chromosome may be split into two in at least one of the constituent genomes of the amphidiploid Malus chromosome complement. Our data suggest that PG1 arose from the fusion of two ancestral chromosomes, A1 and A2, which correspond to FG4 and FG2, respectively, in strawberry. The region of PG1 where the fission/fusion occurred in the Prunus-apple comparison (38–44 cM from the top of PG1) is also compatible with that of the Prunus-Fragaria (estimated to be in the region of 25–45 cM from the top of PG1). Interestingly, most of PG8, one of the Prunus chromosomes with the fewest number of markers and with the smallest genetic distance, appears to be integrated into FG2, with five of the six anchor markers studied being in the same order in PG8 and FG2. This situation may be the result of the fission of A1 in Prunus but not in Fragaria.

Discussion

The comparison between the maps of Prunus and diploid Fragaria has been performed with 71 common markers. Most of them were mapped already in the Prunus map and were added to the strawberry map here. These markers resulted in good coverage of both genomes: 78% of the total distance of the reference maps of both Prunus [14] and strawberry [18]. The average density of anchor markers was of 7.3 cM/marker with a maximum gap of 22 cM (in PG6) for Prunus and 8.0 cM/marker and a maximum gap of 32 cM (in FG3) for Fragaria. The total map distance of the Prunus (519 cM) and the Fragaria (569 cM) maps were similar when constructed with all markers available [14, 18]. Given that the genome size of Prunus is approximately twice that of strawberry these results suggest that the overall recombination rate per physical unit distance for the Fragaria FV×FN hybrid was higher than for the almond × peach F1 individual that generated the T×E F2 population.

For the comparison between the two genomes, we selected 65 RFLP probes, all from Prunus or Malus species, which produced good hybridization and were single copy in the Prunus genome. These probes were studied in strawberry with the same stringency conditions as in Prunus and 16 (24%) produced poor or no hybridization, suggesting that they were not present in the strawberry genome or that their sequences differed substantially from those of Prunus. Some of the probes that did not hybridize were located together in the same regions of the Prunus genome where several probes covering short genetic distances (<10 cM per region) did not hybridize, such as the central region of PG1 and the upper extreme of PG6 (Table 1). The three probes that did not hybridize in the PG1 region were two from a peach cDNA library (PC85 and PC15) and one from a genomic library of P. ferganensis (FG16). Two of them (PC15 and FG16) were sequenced (Table 1) and had homology with known proteins. The region of PG6 had four markers (AG13, AG54, AG40 and PLG59), all of them from Prunus genomic libraries. Only AG40 was sequenced and its sequence had no homology with protein sequences. These results suggest that the corresponding regions, or at least the specific sequences tested, may be deleted in the strawberry genome. Given that some of the probes are homologous to proteins that are usually present as gene families such as polygalacturonase (FG16) and defensin protein 1 (PC15), an alternative explanation is that they may correspond to copies of these genes with high sequence divergence from those present in strawberry.

From the 40 RFLP probes that produced good hybridization and that were polymorphic, 14 (35%) detected two loci in strawberry, whilst in Prunus they were single-locus (Table 1). Tanksley et al. [27] found that five (12%) of the 42 tomato cDNA probes which they mapped in pepper had a different number of copies in each species. These differences in copy number may be due to differential deletions of duplicated DNA fragments existing in the ancestral genome from which Prunus and Fragaria originate. The presence of these duplications complicates the genome comparison because, if only one locus of the two can be mapped, as with the RFLPs mapped here in Fragaria, in half of the cases, the position of the marker could be interpreted as the presence of a spurious genetic rearrangement.

The number of RFLPs mapped in T×E that were single copy, detected with Rosaceae probes, segregated in the strawberry population and had a good distribution along the Prunus map, was insufficient for a good coverage of the Prunus genome. This was due in part to the fact that approximately half of the probes used for RFLP mapping in Prunus have more than one copy [28, 29] and that a substantial number of probes used in T×E (30%) come from families other than the Rosaceae [14]. To solve this problem, we used the available EST and physical map information in Prunus to find ESTs placed in most of the uncovered regions. We then mapped these ESTs by an efficient and expensive approach, resequencing, using a cheap mapping strategy, bin mapping. This allowed us to cover most gaps of the Prunus genome and to reduce the maximum gap without anchor markers in this species to 22 cM. Given the fast rate of growth of the information on the Prunus transcript map, this strategy is likely to allow us a more detailed analysis of synteny in the near future.

Figure 2 shows that the level of synteny between Prunus and Fragaria is high, with most of the markers that mapped to the same linkage group in one species mapping to one or two linkage groups in the other. However, the colinearity is only partial, with an estimated number of nine chromosomal rearrangements involving two chromosomes (translocations or fusion/fission events) and 27 inversions. The number of translocations and fusion/fission events is high if we compare it with other confamilial comparisons where this number has been estimated. Only the distant Solanaceae genomes of pepper and tomato, with 10 of these rearrangements estimated [30], yielded similar results. However, the predominance of inversions over other rearrangements that we found in the Prunus-Fragaria genome comparison is frequent in the Plant Kingdom, such as in the comparisons between tomato and potato [31], tomato and eggplant [2], tomato and pepper [30], Brassica nigra and Arabidopsis thaliana [32] or a. thaliana and A. lyrata [33].

The centromeres or heterochromatic regions around the centromeres are often where breakpoints occur, leading to chromosomal rearrangements. Most inversions and translocations in the Solanaceae [30, 34] and Poaceae [35] had their breakpoints at or near the centromere. This information may be useful to deduce the position of the centromeres of some of the Prunus or Fragaria chromosomes. For example, based on the position where we hypothesize that a fusion event occurred between ancestral chromosomes A1 and A2 to form PG1, we may infer that the centromere is located in the central part of this chromosome (30–45 cM from the top). This is consistent with the metacentric nature of peach chromosome 1. Schubert [36] proposed a model for chromosome fusion where a reciprocal translocation between an acrocentric or telocentric chromosome and another chromosome may generate a larger fused chromosome plus a small chromosome that is eventually lost. Following this model, one of FG2, FG4 or both, or their ancestral chromosomes (A1 and A2), was probably acrocentric. Other metacentric chromosomes may be those that are composed of parts (possibly entire translocated arms) of two chromosomes of the other species; this may be the case of PG7, PG6, FG1, FG6 and FG3 (see Figure 3). In the case of PG6, a reciprocal translocation with PG8 was previously reported in peach [37]. The breakpoint was estimated to be located in the region of 18–39 cM from the top of PG6, which coincides with the region of junction between the fragments of FG1 and FG3 (18–35 cM) and may correspond to centromeric regions of these three chromosomes. On the other hand, the translocation breakpoint of PG8 [37] is located in its distal region, suggesting that it is an acrocentric chromosome.

A rate of 0.14(± 0.06) structural mutations per chromosome per million years (My) of divergence was estimated [6] from the analysis of various macrosynteny comparisons in plants. Considering this rate, our estimation of a number of at least 36 chromosomal rearrangements between Prunus and Fragaria, assuming that the initial number of chromosomes of the common ancestor was x = 9, allows us to estimate that the divergence of these two species dates from approximately 29 Mya. This places these two genera as distant taxa within the Rosaceae, similar to maize and sorghum in the Poaceae (~24 Mya) but closer than tomato and pepper in the Solanaceae (~40 Mya), maize and rice or wheat and rice, both with an estimated divergence time of ~66 Mya [6].

Our results indicate that there is sufficient synteny between the genomes of Fragaria and Prunus to allow the information on marker or gene or quantitative trait locus (QTL) position from one of these species to be used in the other. For example, the gene that determines the ability to produce runners (vegetative propagules) in strawberry (R/r) is located on FG2 at a position syntenic to the region of PG1 where the Evergrowing gene (Evg/evg) that determines continuous leaf production [38] and a QTL that determines blooming time in peach are located [39]. The gene for seasonal vs. perpetual flowering in strawberry (S/s) maps to a region of FG6 (proximal to the SSR EMFn017), that in our comparison roughly coincides with a PG7 fragment where a major QTL determining blooming time in peach lies [39]. These comparisons are however preliminary and need to be studied in more detail, but are a first insight into other possible comparisons that may facilitate the advancement on the knowledge of the genetics of key characters of the Rosaceae.

Conclusion

Whilst the economical importance of peach and its relatively easy manipulation (shorter intergeneration period and self-compatibility) compared to other fruit tree species have determined that many genes have been studied [40] and that the position of at least 28 of them has been established on the Prunus map [14], the diploid strawberry has important advantages, i.e., a genome of a size similar to that of Arabidopsis, ease of genetic transformation, and a rapid life-cycle. In addition, the plants are small, and produce a large number of seed per cross, and thus diploid strawberry may become a very efficient organism for reverse genetics and other genomics applications that may provide useful information for other Rosaceous species, particularly fruit tree crops [41]. This will be facilitated by the information on map comparisons between these two genera that we present in this paper.

Methods

Plant material

The parents and progeny of two mapping populations were used for comparing the Prunus and Fragaria genomes, those of the F2interspecific Prunus reference mapping population (N = 82) derived from the F1 cross between the almond (P. dulcis) cultivar 'Texas' and the peach (P. persica) cultivar 'Earlygold' (abbreviated T×E) and the F2 interspecific diploid Fragaria reference mapping population (N = 76) derived from the F1 cross of F. vesca 815 × F. nubicola 601 (abbreviated FV×FN). The T×E map is composed of 562 markers (185 SSRs, 361 RFLPs, 11 isoenzymes and 5 STSs) [14], whilst the FV×FN map currently consists of 182 markers (175 SSRs, 6 gene specific markers and 1 SCAR) [18]. Most markers used were selected from T×E and subsequently mapped in FV×FN.

DNA extraction

For Fragaria, one gram of young expanding leaves of each individual was collected and kept at -80°C before DNA isolation. Genomic DNA was isolated from the leaf samples using the CTAB method of Doyle and Doyle [42], followed by DNeasy miniprep kit purification (Qiagen). DNA concentrations were measured using a Gene Quant II spectrophotometer (Pharmacia Biotech). For Prunus, DNA was extracted as described in [28].

RFLP markers

A total of 65 probes from various Prunus species and apple were used for RFLP analysis (Table 1). These probes were selected from those used in the construction of the Prunus reference map [14] to be single-copy and covering the whole genome at approximately even distances of 10–25 cM. RFLP analysis was performed with the procedure of Viruel et al. [28]. DNA probes were first hybridized in the parents of the FV×FN population and those that detected RFLPs were studied later in all F2 individuals.

Markers based on Fragaria or PrunusESTs

An additional set of markers was developed from the Prunus transcript map, i.e. the collection of EST unigenes that are located on the same BAC or the same BAC contig of the peach physical map as mapped markers (usually RFLPs) of the reference linkage map [43]. We analysed 515 T×E ESTs currently anchored in the Prunus transcript map (found in the Genome Database for Rosaceae) to find homologous EST sequences in Fragaria by using the TBLASTX program [44]. The selected sequences (only sequences with an e-value <1.00E-15) (Table 2) were then analyzed with TBLASTN, and the most homologous regions were selected for primer design. Primers were designed to include putative Fragaria introns based on the Arabidopsis genome sequence [45] and to give an expected amplicon size >800 bp, using the program Primer3 [46].

For SNP detection, Fragaria ESTs were PCR-amplified in the parents of the Fragaria mapping population in a temperature-gradient PCR to obtain the optimum annealing temperature for each EST primer pair. The PCR reactions were performed as described in [47] and amplification products were sequenced with an ABI PRISM 3700 DNA Analyzer and SNPs were detected between the two parental lines through sequence alignment using the STADEN package [48] and verified by visual inspection of the DNA chromatograms. The same procedure was followed for Prunus ESTs of the transcript map for which we did not find homologous Fragaria ESTs.

The sequences of the primers used for the development of these markers can be found in Table 4. The terminology used for the EST derived markers was: E (for EST), a two letter code for the species where the EST was obtained (Fv, Fa or Pp for F. vesca, F. x ananassa and P. persica, respectively), two additional letters for the place where the EST was obtained (i.e. NH for University of New Hampshire, VB for Virginia Bioinformatics Institute, UF for University of Florida, TR for Trisaia Research Center and CU for Clemson University) and four numbers that correspond to the last four digits of the EST EMBL accession number.
Table 4

Gene and EST-based marker primer sequences. Primers used for DNA amplification in the markers obtained from Fragaria gene or EST or Prunus EST sequences.

Origin

Locus name

Forward primer sequence 5' – 3'

Reverse primer sequence 5' – 3'

Referencea

Fragaria gene

EKO

ACAGTCCAGCTCCAATAGTTCC

GCTTTCCCATTGATTCTTGTCC

AY462247

 

F3H

GAGTTGATACCAAGCTCATCTCG

GTCACCTCTCTCCATCCTTCC

AB097151

 

DFR

CCACTCCTATGGATTTTGAGTCC

CTAGCACCCCATTTATTGTTGG

AB095030

 

ADH

GCKTCAMGAATTATYGGKGTTG

ATGGGASTTKRTGGGTGATG

X15588

Fragaria EST

EFvVB2179

ATCTGCGTGACAATGCAAAG

AAGAGCCTTCAGTTGCTCCA

CX662179

 

EFvVB2119

GCTCGAGCTGATTACGATTACC

TAAAGGACCCATCAGAGAAACG

CX662119

 

EFvNH8894

GGTTAGGTCTCCCCAGTGGT

GGACGTCTCCCACTAGCATC

DV438894

 

EFvVB1231

CCAACTGTGACATCCACGAC

GCTGTCACGCAGAAAATCAA

CX661231

 

EFaUF6868

GCTCTTCCAGGTCGAGTACG

GTTTCCACTTGGGCAGTTGT

CO816868

 

EFaTR1976

GTTGGTGCTGAGTTTGGTGA

CCCAACTGCTCAAGAAGGAG

CO381976

 

EFaUF7699

GTTCTTGTTGGTGGAAGCAC

CCTCAAAGACCTGAATGGAG

CO817699

 

EFaUF7084

CAGAAGAGGTTCAAGTTCC

ACACCATAGCAAGCCCTG

CO817084

 

EFvNH8484

TTCTGGTGTCGGCAAGTC

AGGCCTGCTCAACATTGG

DV438484

 

EFvVB2013

GTGCAGTTGCCAAAGGAGC

AGCTGGGTTTGCTGCTT

CX662013

 

EFvNH9852

TTCTGTCGTGGTGTCCC

ATGATCTTTTGGCGACCA

DV439852

 

EFvNH7822

GATGCTGGGTCTGCTGGG

GCCTGCTCATTGGCATA

CO817822

 

EFaUF7248

ACTGCTCGCCCAATGAAG

TCACATCAGCATCCATGTCA

CO817248

 

EFavB1923

GGCCGTGTCTCTTGCAGT

TGGGAGCAAATCCACCTT

CX661923

 

ACO

AGCACCTTCTACCTCAAACACC

CTCACAGAACAAGTCCAAGAGC

AF129073

Prunus EST

EPpCU9642

TTCAGTTGGCAGATCCTGTG

TGCTGAGACCCTTCCAATTT

BU039642

 

EPpCU1785

TTTTCCAAACCTTGCTGGAG

GCAGTAGCTGTGGCAATGAA

BU041785

 

EPpCU7308

GGCAGGCCGCTCTTATACTA

GACTCTTTTCGGGGTTCCA

BU047308

 

EPpCU9257

CACCACCGTTTCAAAAGAGG

CTGAAGCTCTAGCTGAGGCAAG

BU039257

 

EPpCU1830

TGATGCAATTGGCACAAAGC

CCTATCACCACTTACTTCACTGC

BU041830

 

EPpCU9910

ATAACTCTGCCATCCGAATCC

CATTCCTTGAACAGATCCTTGC

BU039910

 

EPpCU9223

AACAGAGCCAAGCTTATGCAG

TTTCTGCGCAACCGCATC

BU039223

 

EPpCU2875

AACTCAGAGACATATCTGCACAGG

AAGTTGAAGCGGTCTTCATAGG

BU042875

aEMBL accession numbers for the sequences from which novel primer pairs were designed

Fragariagene-specific markers

Eight further gene specific loci that had previously been mapped in the FV×FN population [21] were mapped in the T×E population. The primer pairs used for amplification of four of these genes (CEL-2, PES, ANS and APX) were previously described by Sargent et al. [21] whilst primer pairs for the remaining four (EKO, F3H, DFR and ADH) were designed following the procedures of Sargent et al. [21] from gene sequences deposited in the EMBL database and are listed in Table 4. The primer pairs were used to amplify products from the parents of the Prunus mapping population following the procedure of Sargent et al. [47] and SNPs were detected as described above.

Microsatellite markers

One SSR (ACO) developed in the 5' UTR of Prunus 1-aminocyclopropane-1-carboxylate oxidase gene (ACC oxidase; AF129073) was used to locate this gene, which was already mapped in Fragaria [21], onto the T×E map. The primers used are listed in Table 4. Another apricot SSR, AMPA112, previously described by Hagen et al. [49], was polymorphic in both reference populations and was also included in the map comparison. PCR reactions were performed as described by [50].

Map construction in Fragaria and bin mapping in Prunus and Fragaria

The T×E map of Dirlewanger et al. [14], constructed with MapMaker/EXP v. 3.0 [51], was used as a standard for map comparisons. Data for the FV×FN map, originally constructed with Joinmap 3.0 [52] by Sargent et al. [18], was used for the mapping of novel loci in Fragaria. However, in order to make both maps comparable, the same data of the FV×FN map plus those obtained here were used, but the map was reconstructed with MapMaker. The Kosambi mapping function was used to convert recombination units into genetic distances. The mapping procedure followed the guidelines of previous maps constructed in Prunus [29]. The usual notation for the eight linkage groups of Prunus is G1 to G8 and for the seven Fragaria groups is I-VII. In order to facilitate the map comparison we have used on this occasion the terminology PG1–PG8 for Prunus and FG1–FG7 for Fragaria.

A subset of six plants of the T×E mapping population having a high number of recombination breakpoints and a uniform distribution across the Prunus genome was selected by Howad et al. [15]. The genotype of this set of plants (the bin set) identified 64 fragments (bins) of the Prunus map with average size 7.8 cM. Following a similar approach, a bin set of six plants was selected from the FV×FN mapping population by Sargent et al. [22]. The Fragaria bin set detected 46 fragments of its genome with an average length of 12.6 cM. Using the bin sets of both species allowed us to establish the position of some of the markers with lower cost and effort than mapping with the whole population.

Mapping strategy

Table 3 summarizes the mapping strategy employed for all novel markers mapped in this investigation. All RFLPs used were already mapped in Prunus using the entire T×E progeny and were mapped in Fragaria using the entire FV×FN population. The Fragaria and Prunus ESTs found to be polymorphic in the parents of the Fragaria mapping population were either sequenced in the Fragaria bin set and bin-mapped, or mapped in the whole FV×FN population when clear intron length polymorphisms were detected. The eight Fragaria ESTs, previously mapped in FV×FN, were bin mapped in Prunus. The SSRs were mapped in Prunus and Fragaria using all individuals of these populations. The data for each marker were scored independently by two researchers. Conflicting results were re-examined and in case of disagreement, the most conservative option was taken.

Estimating the number of chromosomal rearrangements

To estimate the number of chromosomal rearrangements that have occurred between Prunus and Fragaria since they diverged from a common ancestor, we elaborated a list of the markers of each of the Fragaria linkage groups with their correlative position on the Prunus linkage map. Taking FG1 as an example, this linkage group has seven anchor markers with order 7.2 (PG7, position 2), 7.3, 7.5, 7.4, 6.10, 6.6, 6.7. Then, we deduced the minimal number of mutations that would place the positions of these markers in the same order as in Prunus. In the example of FG1, we counted one translocation (between PG7 and PG6) and two inversions, one involving the 7.4–7.5 fragment and the other the 6.6–6.7 fragment, to give the final marker order: 7.2, 7.3, 7.4, 7.5, 6.10, 6.7, and 6.6. An additional mutation (probably caused by a translocation) had to occur to explain the gap between 6.10 and 6.7. This mutation was considered when analyzing the chromosome that received the translocated fragment. We counted one breakpoint per translocation and one per inversion. This is a lower boundary, as inversions may require one breakpoint if they involve the distal part of a chromosome, or two if they correspond to an internal fragment of a chromosome. Finally, we considered as translocations only those regions comprising two or more markers, as single-locus translocations are more likely to be spurious.

Declarations

Acknowledgements

This research was supported in part with funds of the Spanish Ministry of Education project INIA (RTA2007-00063-00-00). Rosaceous genomics at East Malling is sponsored by Defra.

Authors’ Affiliations

(1)
IRTA. Centre de Recerca en Agrigenòmica CSIC-IRTA-UAB
(2)
East Malling Research (EMR)
(3)
Universidad Politécnica de Valencia, Centro de Conservación y Mejora de la Agrodiversidad Valenciana (COMAV)

References

  1. Tanksley SD, Ganal MW, Prince JP, De Vicente MC, Bonierbale MW, et al: High density molecular linkage maps of the tomato and potato genomes. Genetics. 1992, 132: 1141-1160.PubMedPubMed Central
  2. Doganlar S, Frary A, Daunay MC, Lester RN, Tanksley SD: A comparative genetic linkage map of eggplant (Solanum melongena) and its implications for genome evolution in the Solanaceae. Genetics. 2002, 161: 1697-1711.PubMedPubMed Central
  3. Devos KM, Gale MD: Genome relationships: the grass model in current research. Plant Cell. 2000, 12: 637-646. 10.1105/tpc.12.5.637.PubMedPubMed CentralView Article
  4. Choi HK, Mun JH, Kim DJ, Zhu HY, Baek JM, Mudge J, Roe B, Ellis N, Doyle J, Kiss GB, Young ND, Cook DR: Estimating genome conservation between crop and model legume species. Proc Natl Acad Sci USA. 2004, 101: 15289-15294. 10.1073/pnas.0402251101.PubMedPubMed CentralView Article
  5. Schranz ME, Song BH, Windsor AJ, Mitchell-Olds T: Comparative genomics in the Brassicaceae: a family-wide perspective. Curr Opin Plant Biol. 2007, 10: 168-175. 10.1016/j.pbi.2007.01.014.PubMedView Article
  6. Paterson AH, Lan TH, Reischmann KP, Chang C, Lin YR, et al: Toward a unfied genetic map of higher plants, transcending the monocot-dicot divergence. Nature Genet. 1996, 14: 380-386. 10.1038/ng1296-380.PubMedView Article
  7. Salse J, Piégu B, Cooke R, Delseny M: Synteny between Arabidopsis thaliana and rice at the genome level: a tool to identify conservation in the ongoing rice genome sequencing project. Nucleic Acids Res. 2002, 30: 2316-2328. 10.1093/nar/30.11.2316.PubMedPubMed CentralView Article
  8. Dominguez I, Graziano E, Gebhardt C, Barakat A, Berry S, Arús P, Delseny M, Barnes S: Plant genome archaeology: evidence for conserved ancestral chromosome segments in dicotyledonous plant species. Plant Biotech J. 2003, 1: 91-99. 10.1046/j.1467-7652.2003.00009.x.View Article
  9. Rong J, Bowers JE, Schulze SR, Waghmare VN, Rogers CJ, et al: Comparative genomics of Gossypium and Arabidopsis: Unraveling the consequences of both ancient and recent polyploidy. Genome Res. 2005, 15: 1198-1210. 10.1101/gr.3907305.PubMedPubMed CentralView Article
  10. Judd WS, Campbell CS, Kellogg EA, Stevens PF: Plant systematics, a phylogenetic approach. Sunderland M.A. Sinauer Associates; 1999.
  11. Akiyama Y, Yamamoto Y, Ohmido N, Oshima M, Fukui K: Estimation of the nuclear DNA content of strawberries (Fragaria spp.) compared with Arabidopsis thaliana by using dual system flow cytometry. Cytologia. 2001, 66: 431-436.View Article
  12. Arumuganathan K, Earle ED: Nuclear DNA content of some important plant species. Plant Mol Biol Rep. 1991, 9: 208-218. 10.1007/BF02672069.View Article
  13. Arús P, Yamamoto T, Dirlewanger E, Abbott AG: Synteny in the Rosaceae. Plant Breeding Reviews. Edited by: Janick J. 2005, London, John Wiley and Sons Inc, 175-211.
  14. Dirlewanger E, Graziano E, Joobeur T, Garriga-Caldere F, Cosson P, Howad W, Arus P: Comparative mapping and marker-assisted selection in Rosaceae fruit crops. Proc Nat Acad Sci USA. 2004, 101: 9891-9896. 10.1073/pnas.0307937101.PubMedPubMed CentralView Article
  15. Howad W, Yamamoto T, Dirlewanger E, Testolin R, Cosson P, Cipriani G, Monforte AJ, Georgi L, Abbott AG, Arus P: Mapping with a few plants: using selective mapping for microsatellite saturation of the Prunus reference map. Genetics. 2005, 171: 1305-1309. 10.1534/genetics.105.043661.PubMedPubMed CentralView Article
  16. Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg van de WE, Hayashi T: Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Hort. 2004, 663: 51-56.View Article
  17. Pierantoni L, Cho KH, Shin IS, Chidoni R, Tartarini S, Dondini L, Kang SJ, Sansavini S: Characterisation and transferability of apple SSRs to two European pear F1 populations. Theor Appl Genet. 2004, 109: 1519-1524. 10.1007/s00122-004-1775-9.PubMedView Article
  18. Sargent DJ, Clarke J, Simpson DW, Tobutt KR, Arus P, Monfort A, Vilanova S, Denoyes-Rothan B, Rousseau M, Folta KM, Bassil NV, Battey NH: An enhanced microsatellite map of diploid Fragaria. Theor Appl Genet. 2006, 112: 1349-1359. 10.1007/s00122-006-0237-y.PubMedView Article
  19. Jung S, Jesudurai C, Staton M, Du ZD, Ficklin S, Cho IH, Abbott A, Tomkins J, Main D: GDR (Genome Database for Rosaceae): integrated web resources for Rosaceae genomics and genetics research. BMC Bioinformatics. 2004, 5: 130-10.1186/1471-2105-5-130. [http://www.bioinfo.wsu.edu/gdr/]PubMedPubMed CentralView Article
  20. Potter D, Eriksson T, Evans RC, Oh S, Smedmark JEE, Morgan DR, Kerr M, Robertson KR, Arsenault M, Dickinson TA, Campbell CS: Phylogeny and classification of Rosaceae. Plant Syst Evol. 2007, 266: 5-43. 10.1007/s00606-007-0539-9.View Article
  21. Sargent DJ, Rijs A, Nier S, Simpson DW, Tobutt KR: The development and mapping of functional markers in Fragaria and their transferability and potentialfor mapping in other genera. Theor Appl Genet. 2007, 114: 373-384. 10.1007/s00122-006-0441-9.PubMedView Article
  22. Sargent DJ, Cipriani G, Vilanova S, Gil-Ariza D, Arús P, Simpson DW, Tobutt KR, Monfort A: The development of a bin mapping population and the selective mapping of 103 markers in the diploid Fragaria reference mapping population FV×FN. Genome. 2008, 51: 120-127. 10.1139/G07-107.PubMedView Article
  23. Morgan DR, Soltis DE, Robertson KR: Systematic and evolutionary implications of the RBC L sequence variation in Rosaceae. Amer J Bot. 1994, 81: 890-903. 10.2307/2445770.View Article
  24. Salesses G, Mouras A: Tentative d'utilisation des protoplastes pour l'etude des chromosomes chez les Prunus. Ann Amelior Plantes. 1977, 27: 363-368.
  25. Bouvier L, Lespinasse Y, Schuster M: Karyotype analysis of an haploid plant of apple (Malus domestica). Acta Horticulturae. 2000, 538: 321-324.View Article
  26. Iwatsubo Y, Naruhashi N: Karyotypes of three species of Fragaria (Rosaceae). Cytologia. 1989, 54: 493-497.View Article
  27. Tanksley SD, Bernatzky R, Lapitan NL, Prince JP: Conservation of gene repertoire but not gene order in pepper and tomato. Proc Natl Acad Sci USA. 1988, 85: 6419-6423. 10.1073/pnas.85.17.6419.PubMedPubMed CentralView Article
  28. Viruel MA, Messeguer R, de Vicente MC, Garcia-Mas J, Puigdomenech P, et al: A linkage map with RFLP and isozyme markers for almond. Theor Appl Genet. 1995, 91: 964-971. 10.1007/BF00223907.PubMedView Article
  29. Joobeur T, Viruel MA, de Vicente MC, Jauregui B, Ballester J, Dettori MT, Verde I, Truco MJ, Messeguer R, Batlle I, Quarta R, Dirlewanger E, Arus P: Construction of a saturated linkage map for Prunus using an almond × peach F2 progeny. Theor Appl Genet. 1998, 97: 1034-1041. 10.1007/s001220050988.View Article
  30. Livingstone K, Lackney VK, Blauth JR, Wijk RV, Jahn MK: Genome mapping in Capsicum and the evolution of genome structure in the Solanaceae. Genetics. 1999, 152: 1183-1202.PubMedPubMed Central
  31. Bonierbale MW, Plaisted RL, Tanksley SD: RFLP maps based on a common set of clones reveal modes of chromosomal evolution in potato an tomato. Genetics. 1988, 120: 1095-1103.PubMedPubMed Central
  32. Lagercrantz U: Comparative mapping between Arabidopsis thaliana and Brassica nigra Indicates that Brassica genomes have evolved through extensive genome replication accompanied by chromosome fusions and frequent rearrangements. Genetics. 1998, 150: 1217-1228.PubMedPubMed Central
  33. Yogeeswaran K, Frary A, York TL, Amenta A, Lesser AH, Nasrallah JB, Tanksley SD, Nasrallah ME: Comparative genome analyses of Arabidopsis spp.: Inferring chromosomal rearrangement events in the evolutionary history of A. thaliana. Genome Res. 2006, 15: 505-515. 10.1101/gr.3436305.View Article
  34. Paterson AH, Bowers JE, Burow MD, Draye X, Elsik CG, Jiang CX, Katsar CS, Lan TH, Lin YR, Ming RG, Wright RJ: Comparative genomics of plant chromosomes. Plant Cell. 2000, 12: 1523-1539. 10.1105/tpc.12.9.1523.PubMedPubMed CentralView Article
  35. Moore G, Roberts M, Aragon-Alcaide L, Foote T: Centromeric sites and cereal chromosome evolution. Chromosoma. 1997, 105: 321-323.PubMed
  36. Schubert I: Chromosome evolution. Curr Opin Plant Biol. 2007, 10: 109-115. 10.1016/j.pbi.2007.01.001.PubMedView Article
  37. Jáuregui B, de Vicente MC, Messeguer R, Felipe A, Bonnet A, Salesses G, Arus P: A reciprocal translocation between 'Garfi' almond and 'Nemared' peach. Theor Appl Genet. 2001, 102: 1169-1176. 10.1007/s001220000511.View Article
  38. Bielenberg DG, Wang Y, Fan S, Reighard GL, Scorza R, Abbott AG: A deletion affecting several gene candidates in present in the evergrowing peach mutant. J Hered. 2004, 95: 436-444. 10.1093/jhered/esh057.PubMedView Article
  39. Silva C, Garcia-Mas J, Sanchez AM, Arús P, Oliveira MM: Looking into flowering time in almond (Prunus dulcis (Mill) D.A. Webb): the candidate gene approach. Theor Appl Genet. 2005, 110: 959-968. 10.1007/s00122-004-1918-z.PubMedView Article
  40. Monet R, Guye A, Roy M, Dachary N: Peach Mendelian genetics: a short review and new results. Agronomie. 1996, 16: 321-329. 10.1051/agro:19960505.View Article
  41. Folta KM, Davis TM: Strawberry genes and genomics. Critical Rev Plant Sci. 2006, 25: 399-415. 10.1080/07352680600824831.View Article
  42. Doyle JJ, Doyle JL: A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 1987, 19: 11-15.
  43. Horn R, Lecouls AC, Callahan A, Dandekar A, Garay L, McCord P, Howad W, Chan H, Verde I, Main D, Jung S, Georgi L, Forrest S, Mook J, Zhebentyayeva T, Yu YS, Kim HR, Jesudurai C, Sosinski B, Arus P, Baird V, Parfitt D, Reighard G, Scorza R, Tomkins J, Wing R, Abbott AG: Candidate gene database and transcript map for peach, a model species for fruit trees. Theor Appl Genet. 2005, 110: 1419-1428. 10.1007/s00122-005-1968-x.PubMedView Article
  44. Atschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997, 25: 3389-3402. 10.1093/nar/25.17.3389. [http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi]View Article
  45. Arabidopsis genome sequence. [http://arabidopsis.org]
  46. Primer3. [http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi]
  47. Sargent DJ, Hadonou AM, Simpson DW: Development and characterisation of polymorphic microsatellite markers from Fragaria viridis, a wild diploid strawberry. Mol Ecol Notes. 2003, 3: 550-552. 10.1046/j.1471-8286.2003.00507.x.View Article
  48. Staden R: The Staden sequence analysis package. Mol Biotechnol. 1996, 5: 233-241. 10.1007/BF02900361.PubMedView Article
  49. Hagen LS, Chaib J, Fady B, Decroocq V, Bouchet JP, Lambert P, Audergon JM: Genomic and cDNA microsatellites from apricot (Prunus armeniaca L.). Mol Ecol Notes. 2004, 4: 742-745. 10.1111/j.1471-8286.2004.00802.x.View Article
  50. Monfort A, Vilanova S, Davis TM, Arús P: A new set of polymorphic simple sequence repeat (SSR) markers from a wild strawberry (Fragaria vesca) are transferable to other diploid Fragaria species and to Fragaria x ananassa. Mol Ecol Notes. 2006, 6: 197-200. 10.1111/j.1471-8286.2005.01191.x.View Article
  51. Lander ES, Gree P, Abrahansom J, Barlow A, Daly MJ, et al: MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics. 1987, 1: 174-181. 10.1016/0888-7543(87)90010-3.PubMedView Article
  52. Van Ooijen JW, Voorrips RE: Joinmap 3.0:software for the calculation of genetic linkage maps. Plant research International, Wageningen, The Nederlands; 2001.

Copyright

© Vilanova et al; licensee BioMed Central Ltd. 2008

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement