Open Access

Characterization and transferability of microsatellite markers of the cultivated peanut (Arachis hypogaea)

  • Marcos A Gimenes1, 2Email author,
  • Andrea A Hoshino1,
  • Andrea VG Barbosa1,
  • Dario A Palmieri1 and
  • Catalina R Lopes1
BMC Plant Biology20077:9

DOI: 10.1186/1471-2229-7-9

Received: 03 March 2006

Accepted: 27 February 2007

Published: 27 February 2007

Abstract

Background

The genus Arachis includes Arachis hypogaea (cultivated peanut) and wild species that are used in peanut breeding or as forage. Molecular markers have been employed in several studies of this genus, but microsatellite markers have only been used in few investigations. Microsatellites are very informative and are useful to assess genetic variability, analyze mating systems and in genetic mapping. The objectives of this study were to develop A. hypogaea microsatellite loci and to evaluate the transferability of these markers to other Arachis species.

Results

Thirteen loci were isolated and characterized using 16 accessions of A. hypogaea. The level of variation found in A. hypogaea using microsatellites was higher than with other markers. Cross-transferability of the markers was also high. Sequencing of the fragments amplified using the primer pair Ah11 from 17 wild Arachis species showed that almost all wild species had similar repeated sequence to the one observed in A. hypogaea. Sequence data suggested that there is no correlation between taxonomic relationship of a wild species to A. hypogaea and the number of repeats found in its microsatellite loci.

Conclusion

These results show that microsatellite primer pairs from A. hypogaea have multiple uses. A higher level of variation among A. hypogaea accessions can be detected using microsatellite markers in comparison to other markers, such as RFLP, RAPD and AFLP. The microsatellite primers of A. hypogaea showed a very high rate of transferability to other species of the genus. These primer pairs provide important tools to evaluate the genetic variability and to assess the mating system in Arachis species.

Background

The origin and the diversity center of the genus Arachis are in South America [1]. This genus comprises 69 species, most of which are diploid and wild. The cultivated species include A. hypogaea L., the cultivated peanut, A. glabrata and A. pintoi, which have been used in forage production [2, 3]. This genus is divided into nine sections (Arachis, Erectoides, Heteranthae, Caulorrhizae, Rhizomatosae, Extranervosae, Triseminatae, Procumbentes and Trierectoides) according to their morphology, geographic distribution and sexual compatibility [1].

The extensive morphological variation in A. hypogaea has led to the identification of subspecies, although studies using molecular markers have found little polymorphism in the germplasm of this species [46]. The observed restriction in genetic variation limits the use of several approaches, such as molecular marker-assisted selection and the construction of a molecular map that are essential tools in A. hypogaea breeding.

Cultivated peanut is an allotetraploid that contains genomes A and B, which are found in wild diploid species of section Arachis. This species has arisen probably from a unique cross between the wild diploid species A. duranensis (A genome) and A. ipaënsis (B genome) resulting in a hybrid whose chromosome number was spontaneously duplicated [7]. This duplication isolated A. hypogaea from the wild diploid species not allowing allele exchange with them. The origin through a single and recent polyplodization event, followed by successive selection during breeding efforts, resulted in a highly conserved genome [8]. The morphological variation observed among accessions of A. hypogaea is most probably due to the variation in few genes [9].

Microsatellites are highly polymorphic molecular markers [10], which have been used to analyze genetic variability and to construct molecular maps in several plant species [1114]. Hopkins and colleagues [15] analyzed the genetic variation using six microsatellite primer pairs and 19 accessions of A. hypogaea and three accessions of wild Arachis species (A. duranensis, A. ipaënsis, A. monticola). These authors have observed that despite the low frequency of polymorphism found in A. hypogaea, these microsatellite loci were very informative and could provide a useful tool to identify and partition genetic variation in the cultivated peanut. Fergurson and colleagues [16] developed 226 microsatellite primer pairs for A. hypogaea and from the 192 that amplified well 110 putative loci showed polymorphism in a diverse array of 24 cultivated peanut accessions. Moretzsohn and colleagues [17] analyzing 36 species of Arachis observed the cross species amplification rate of A. hypogaea microsatellite primers was up 76% to species of section Arachis and up to 45% to species of the other eight section of genus Arachis.

Microsatellite markers could be useful to analyze the genetic variation in the germplasm of wild Arachis species. These species have more intraspecific genetic variation detectable than A. hypogaea, as shown by using molecular markers [18, 19], and are resistant to numerous pests and diseases that affect the cultivated peanut [20]. The high cost of developing microsatellite markers is the main factor limiting their widespread use in this genus. A good alternative would be the use of a set of primers to obtain cross-species transferability, as reported in other studies [2124].

The objectives of this study were to isolate and characterize the microsatellite loci of A. hypogaea and to assess the cross-transferability of these markers to other Arachis species.

Results and Discussion

A total of 68 random clones were selected and sequenced. Thirty-eight (55.9%) of them contained microsatellites. Repeat length ranged from 12 bp to 47 bp. Twenty-four (63.1%) microsatellites were perfect, two (5.3%) were imperfect and 12 (31.6%) were compound repeats. From those, 16 clones were chosen to design the primers, since they had more than 10 repeats. Microsatellite sequences formed by less than 10 repeats are considered to be less polymorphic, and thus not very informative.

Seven clones contained AG/TC repeats, three contained AC/TG repeats, five contained AT/TA repeats, and one contained a poly A repeat [(A)35GG(A)9]. Sixty-three percent of the selected clones (10/16) had complementary sequences to the oligonucleotides used in the enrichment procedure. However, the other 37% had different repeats (AT and A) that were not totally complementary to the probes used. The selection of AT sequences using AC and AG oligonucleotides were not reported in other studies where libraries were enriched for these two types of sequences [2527]. In the previous studies the hybridization between the probes and single stranded clones were performed at temperatures superior to 50°C, thus under very stringent conditions, reducing the possibility of selection of clones due to mismatches. In this study, the enrichment was performed at room temperature (around 25°C). Some sequences did not contain repeated sequence indicating that mismatches have happened. However, the frequency of AT in this group was high. This high percentage could be due to the probes used (AC15 and AG15), which could have had up to 50% of their sequences complementary to AT/TA regions. Taking into account only the adenines in these probes, since adenines would pair to the timidines of target or part of the target sequence, temperatures above 35°C would be necessary to break the nitrogen bonds, since 35°C is the melting point of an oligonucleotide formed by 15 adenines. The forementioned temperature is 10°C higher than the room temperature, allowing a more stable association between the probe and the adenine-rich target (AT and poliA) than in adenine-poor targets, increasing the frequency of these motifs in the group of selected sequences due to the mismatch.

Primers were designed and synthesized to 13 of the 16 sequences selected. This set of primers and a primer pair developed by Hopkins and colleagues [15] were used to amplify microsatellite loci in A. hypogaea and in wild diploid species of eight sections of genus Arachis.

The 14 primer pairs allowed the detection of 18 putative loci in A. hypogaea (Table 1). Thus, a number of primer pairs amplified loci in both genomes of A. hypogaea. Four primer pairs (Ah7, Ah21, Ah30 and Ah282) amplified two putative loci in A. hypogaea and one locus in A. duranensis (genome A) and A. ipaënsis (genome B) and the other ten pairs allowed the amplification of a single putative locus that was amplified in A. hypogaea and in A. duranensis or A. ipaënsis (data not shown). Thus, the primers pairs fall into three groups based on the amplification events observed in A. hypogaea and in A. ipaënsis and A. duranensis: 1) those allowing the amplification in A. hypogaea and A. duranensis and detect a putative locus in the A genome, 2) those allowing the amplification of a putative locus in A. hypogaea and A. ipaënsis and detect a locus in the B genome, and 3) those allowing the amplification in A. hypogaea, A. duranensis and A. ipaënsis and detect putative loci in both genomes.
Table 1

Data of each of the 18 putative microsatellite loci of A. hypogaea.

Locus

 

Range (bp)

Allele Frequencies

PIC

   

1

2

3

4

5

6

7

 

Ah2

199

199

1.00

-

-

-

-

-

-

0.00

Ah3

202

220–188

0.03

0.12

0.56

0.18

0.06

0.09

-

0.66

Ah7.1

102

104

1.00

-

-

-

-

-

-

0.00

Ah7.2

 

102

1.00

-

-

-

-

-

-

0.00

Ah11.1

176

180–175

0.41

0.18

0.41

-

-

-

-

0.65

Ah19

197

175

1.00

-

-

-

-

-

-

0.00

Ah20

197

199–197

0.93

0.07

-

-

-

-

-

0.13

Ah21.1

109

114

1.00

-

-

-

-

-

-

0.00

Ah21.2

 

111

1.00

-

-

-

-

-

-

0.00

Ah23

183

165

1.00

-

-

-

-

-

-

0.00

Ah26

182

190–178

0.24

0.12

0.35

0.24

0.06

-

-

0.77

Ah30.1

123

127

1.00

-

-

-

-

-

-

0.00

Ah30.2

 

124

1.00

-

-

-

-

-

-

0.00

Ah51

154

152–124

0.17

0.07

0.40

0.17

0.07

0.07

0.07

0.79

Ah6–125

180

159

1.00

-

-

-

-

-

-

0.00

Ah126

187

200

1.00

-

-

-

-

-

-

0.00

Ah282.1

203

202–196

0.06

0.94

-

-

-

-

-

0.11

Ah282.2

 

182

1.00

-

-

-

-

-

-

0.00

The level of polymorphism varied greatly among the polymorphic loci. Ah51 allowed the amplification of seven alleles and the PIC was 0.79, whereas the least polymorphic primer pair Ah282 amplified only two alleles and presented PIC = 0.11. Primers Ah51 flank a region that comprises the largest number of repeats (34) and the motif was formed by two nucleotides (A and G) whereas Ah282 flanked a region containing two microsatellites, each composed of six trinucleotide repeats. Hopkins and colleagues [15] and He and colleagues [28] observed that some loci, despite their long repeats (20–40), were invariant among the cultivated accessions tested. The difference observed in the studies cited above may have been due to the following: 1 – distinct number of loci were analyzed in these studies; 2 – distinct sets of A. hypogaea accessions were used. Moreover, the invariant microsatellites may be located in genes, what make them less variable despite their long repeats.

Overall, the mean percentage of polymorphic loci was 33%, the mean number of alleles per primer pair within the accessions of A. hypogaea was 4.02, and the PIC was 0.48. In this study, the percentage of polymorphic microsatellite loci was lower than those found in other studies where microsatellite markers were used to evaluate genetic variability within A. hypogaea. Ferguson and colleagues [16] studying a set of 24 accessions of A. hypogaea from 7 countries from different continents found 57.3% of polymorphic microsatellite loci. He and colleagues [28] found that 34% of the microsatellite primer pairs showed polymorphism in a sample that comprised A. hypogaea accessions from eight Latin America countries. Despite the lower percentage of microsatellite loci found in this study, it was higher than the percentage of polymorphic loci in A. hypogaea observed using RAPD [6.6% (29)], and AFLP [6.7% (6); 6.4 %, (30)]. Besides the large percentage of polymorphic loci, Hopkins and colleagues [15] observed that the amount of useful information obtained per polymorphic microsatellite locus was quite high. For instance, in this study, the mean number of alleles was 4.02, and several primer pairs were highly informative, such as primer pair Ah51, which allowed the amplification of seven different fragments.

PCR products were obtained for most of the wild species analyzed (Table 2). In general, fragments close to the size of the fragment expected for A. hypogaea were detected. The transferability of the markers was variable, ranging from 54% for the locus Ah6–125 to 100% for Ah30. The level of polymorphism also varied among loci, ranging from 25 alleles in Ah30 and Ah126 to 15 alleles in Ah11 and Ah20.
Table 2

Sizes (bp) of fragments amplified using eight A. hypogaea microsatellite primer pairs and DNAs of 37 wild Arachis species.

 

Ah2

Ah11

Ah19

Ah20

Ah21

Ah30

Ah6–125

Ah126

Section Arachis

        

   A. batizocoi

286

146

151

--

135

139

--

210

 

330

       

   A. cardenasii

248

155

143

203

139

139

180

191

 

200

 

149

 

141

   

   A. decora

200

194

144

--

136

135

--

185

        

203

   A. aff. diogoi

279

--

143

205

137

126

197

213

 

242

 

149

 

140

 

180

 
 

205

       

   A. duranensis

181

194

143

--

134

140

191

187

 

205

 

147

     

   A. glandulifera

242

--

149

--

140

128

--

216

   A. helodes

242

150

143

208

137

124

174

--

 

205

155

147

  

157

  

   A. hoehnei

215

150

143

196

143

142

186

224

   

147

    

203

   A. ipaënsis

231

161

151

--

132

130

--

203

   A. kempff-mercadoi

286

--

143

200

142

140

186

213

 

196

 

147

     

   A. kuhlmannii

242

155

142

196

138

137

171

200

 

200

 

147

     

   A. magna

231

173

151

--

136

139

--

200

   A. microsperma

286

130

145

189

134

144

178

213

 

205

 

149

     

   A. monticola

231

157

151

196

133

126

182

203

 

196

169

      

   A. palustris

200

150

151

--

135

130

--

210

   A. praecox

--

155

143

--

141

123

--

191

   

144

    

198

   A. simpsonii

200

155

145

203

137

144

180

205

 

341

   

140

   

   A. aff. simpsonii

196

153

143

205

140

133

204

193

 

248

 

149

   

177

 

   A. stenosperma

293

145

142

193

144

130

182

--

 

215

150

149

     

   A. subdigitata

--

 

--

183

--

123

166

196

       

221

 

   A. valida

--

161

143

--

135

139

184

198

   A. villosa

--

155

143

187

134

144

178

203

   

149

     

Section Caulorrhizae

        

   A. pintoi

205

161

143

183

147

128

208

205

   

151

     
   

166

     

   A. repens

205

--

162

--

140

130

--

239

   

170

     

Section Erectoides

        

   A. paraguariensis

200

--

162

167

141

119

208

230

 

187

  

173

    

   A. hermannii

196

--

--

179

139

130

--

219

     

145

   

   A. major

200

153

151

187

144

121

170

230

   

162

     

Section Extranervosae

        

   A. burchellii

197

188

142

--

165

132

--

200

      

153

  
      

284

  

   A. pietrarellii

300

--

141

--

--

129

--

209

      

155

  

   A. prostata

189

--

139

--

133

121

--

194

     

136

153

 

205

   A. macedoi

--

--

142

182

--

122

180

214

   

155

     

   A. villosulicarpa

--

160

144

--

152

124

--

188

      

149

  

Section Rhizomatosae

        

   A. burkartii

--

139

178

175

136

125

--

196

   

241

    

232

   A. glabrata

195

146

158

169

137

125

--

180

   

161

    

192

        

205

   A. pseudovillosa

203

146

158

169

135

122

--

186

   

164

 

138

  

209

        

226

        

239

Section Trierectoides

        

   A. guaranitica

203

189

158

--

137

117

182

196

   

164

     

Section Triseminatae

        

   A. triseminata

187

--

164

--

143

180

--

224

 

203

       
The annealing temperatures used to amplify microsatellite loci in wild Arachis species ranged from 10°C below the melting temperature (Tm) of a given pair of primers to the melting temperature of the primer. The necessity of lower annealing temperatures for some pairs of primer suggested that some microsatellite flanking regions were more conserved than others in the Arachis species analyzed. The data also suggested that changes in the flanking regions most probably resulted from point mutations and small deletions and insertions, since if major rearrangements were responsible for causing the changes, they would probably have resulted in no amplification due to the interruption or deletion of primer-annealing sites. Point mutations and small rearrangements (deletions and/or insertions) were detected in the flanking regions of the Ah11 locus of some species analyzed (Figure 1). For instance, a sequence of five bases (positions 112 to 116) was absent from A. triseminata.
Figure 1

Alignment of nucleotide sequences of 18 Arachis species amplified using primer pair Ah11. Species analyzed: A. valida (1), A. triseminata (2), A. subcoreacea (3), A. cardenasii (4), A. guaranitica (5), A. batizocoi (6), A. repens (7), A. duranensis (8), A. paraguariensis (9), A. burkartii (10), A. ipaënsis (11), A. kuhlmannii (12), A. kempff-mercadoi (13), A. magna (14), A. hoehnei (15), A. decora (16), A. macedoi (17) and A. hypogaea (18). The sequences of all species comprised microsatellites, but the number of repeats varied a lot among them.

The cross-transferability of A. hypogaea markers to species of section Arachis was very high, ranging from 60% for Ah20 to 100% for Ah30. A similar level of microsatellite marker transferability was observed from Triticum aestivum L. to its ancestral diploid species [24]. Section Arachis comprises species with genomes (AA and BB) similar to those found in the cultivated peanut (AABB) showing agronomical value characteristics, which are introgressed into cultivated peanut mainly by means of crosses with synthetic amphidiploids resultant from crosses between A and B genome species. The resulting F1 has to be backcrossed many times to get an off-spring that has the introgressed characteristic and most of the recurrent parental genome. A genetic map constructed using wild diploid species would be useful to guide the introgression of genes from wild species to A. hypogaea. A map would allow the discovery of markers linked to gene(s) or chromosome regions that are responsible or involved in the expressions of introgressed characteristic. Similarly, it would allow the selection of markers distributed all over both genomes of A. hypogaea, helping the selection of plants showing largest percentages of the recurrent parental genome. This approach would be the most efficient way to integrate molecular markers into breeding programs of cultivated peanut, since genetic polymorphism in A. hypogaea is very low [4, 15, 31] and insufficient to construct a genetic map.

Figure 2 shows the relationships among species of Arachis section based on amplification events observed using eight pairs of microsatellite loci from A. hypogaea. Two groups were identified. The first consisting of A. hypogaea, A. monticola and all analyzed genome Aspecies, the second contained the species classified as genome B and A. glandulifera Stalker, classified as genome D [32]. The division into two main groups was based essentially on the absence of amplification of two loci (Ah20 and Ah6–125) in genome B species. Despite the few loci analyzed (8), the groups defined by the dendrogram agreed with previous studies that classified species of the Arachis section into genomes A, B and D. In this study A genomes species were placed closer to A. hypogaea than the B genomes. Tallury and colleages [33] using AFLPs found A ipaënsis and A. williamsii, both B genome species, closer to A. hypogaea than A genome species. This difference on affinities of A and B genome species with A. hypogaea may be due to the type and number of markers used. The data also agreed with the close relationship between A. glandulifera and B genome species [33]. These findings suggested that flanking regions contain useful phylogenetic information.
Figure 2

Phenogram showing the relation among Arachis species based on amplification events obtained using eight primer pairs and 22 Arachis species. The polymorphism was not enough to characterize most species, but they were grouped according the type of their genomes (A, B and D).

PCR products were also obtained for species from sections Caulorrhizae, Erectoides, Extranervosae, Procumbentes, Rhizomatosae, Trierectoides and Triseminatae (Table 3). Five primer pairs, namely Ah2, Ah11, Ah19, Ah30 and Ah126, from the eight primers (62.5%) tested resulted in amplifications from all sections. The pair Ah6–125 (12.5%) produced amplification in six sections, and Ah20 and Ah21 in five sections (25%). Taking into account that 33% of the primers pairs allowed the detection of polymorphism among accessions of A. hypogaea, this set of primers will probably show polymorphism in wild Arachis species, so they could be analyzed using microsatellite loci with no costs to primer development. Cross-transferability of Arachis microsatellite markers was also observed in other studies. Hopkins and colleagues [15] using A. hypogaea microsatellite primers observed cross-amplification in A. monticola, A. ipaënsis and A. duranensis, species that are closely related to A. hypogaea. Moretzsohn and colleagues [17] also using A. hypogaea microsatellite primers observed up to 76% of transferability to species of Arachis section and up to 45% to species of the other eight section of genus Arachis. Moretzsohn and colleagues [34] observed cross amplification and detected polymorphism between A. duranensis (A genome) and A. stenosperma (A genome) using a large number of pair of primers developed for different Arachis species.
Table 3

Species evaluated using A. hypogaea microsatellite primers.

Section

Species

Ploidy

Genome

Collector's numbers

State and country

Arachis

Arachis batizocoi

2n = 20

B

K9484

Bolivia

 

Arachis aff. cardenasii

2n = 20

A

V13721

MT, Brazil

 

Arachis decora

2n = 18

Unknown

V13290

GO, Brazil

 

Arachis linearifolia

2n = 20

Unknown

V9401

MT, Brazil

 

Arachis duranensis

2n = 20

A

V14167

Argentina

 

Arachis glandulifera

2n = 20

D

V13738

MT, Brazil

 

Arachis helodes

2n = 20

A

V6325

MT, Brazil

 

Arachis hoehnei

2n = 20

Unknown

V9140

MS, Brazil

 

Arachis hypogaea

2n = 40

AB

W725

GO, Brazil

  

2n = 40

AB

AsW433

RO, Brazil

  

2n = 40

AB

URY85183

Rivera, Uruguay

  

2n = 40

AB

Pd3147

RS, Brazil

  

2n = 40

AB

V12577

MT, Brazil

  

2n = 40

AB

URY85273

Rivera, Uruguay

  

2n = 40

AB

URY85209

Rivera, Uruguay

  

2n = 40

AB

V12577-1

MS, Brazil

  

2n = 40

AB

Mf1640

Ecuador

  

2n = 40

AB

Mf1670

Ecuador

  

2n = 40

AB

Mf1600

Ecuador

  

2n = 40

AB

V12548

MT, Brazil

  

2n = 40

AB

V10522

SC, Brazil

  

2n = 40

AB

Tatu

SP, Brazil

  

2n = 40

AB

Tatu ST

SP, Brazil

  

2n = 40

AB

166

Not available

 

Arachis ipaënsis

2n = 20

B

K30076

Bolívia

 

Arachis kempff-mercadoi

2n = 20

A

V13530

MS, Brazil

 

Arachis kuhlmannii

2n = 20

A

V6344

MT, Brazil

 

Arachis magna

2n = 20

B

K30097

Santa Cruz, Bolívia

 

Arachis microsperma

2n = 20

A

Sv3837

Paraguay

 

Arachis monticola

2n = 40

AB

V14165

Argentina

 

Arachis palustris

2n = 18

B

V13023

TO, Brazil

 

Arachis praecox

2n = 18

B

V6416

MT, Brazil

 

Arachis simpsonii

2n = 20

A

V13728

Bolívia

 

Arachis aff. simpsonii

2n = 20

A

V13746

MT, Brazil

 

Arachis stenosperma

2n = 20

A

V10309

MT, Brazil

 

Arachis subdigitata

2n = 20

A

V13589

Not available

 

Arachis valida

2n = 20

B

V14041

Not available

 

Arachis villosa

2n = 20

A

V9923

Not available

Caulorrhizae

Arachis pintoi

2n = 20

C

V13356

BA, Brazil

 

Arachis repens

2n = 20

C

V5868

RS, Brazil

Erectoides

Arachis paraguariensis

2n = 20

E

V13546

MS, Brazil

 

Arachis hermannii

2n = 20

E

V10390

MS, Brazil

 

Arachis major

2n = 20

E

V7644

MT, Brazil

Extranervosae

Arachis burchellii

2n = 20

EX

S3766

TO, Brazil

 

Arachis pietrarellii

2n = 20

EX

V12085

MT, Brazil

 

Arachis prostrata

2n = 20

EX

W722

GO, Brazil

 

Arachis macedoi

2n = 20

EX

V9912

Not available

 

Arachis villosulicarpa

2n = 20

EX

V8816

MT, Brazil

Procumbentes

Arachis subcoriacea

2n = 20

E

V8943

MT, Brazil

Rhizomatosae

Arachis burkartii

2n = 20

R

Ff1122

RS, Brazil

 

Arachis glabrata

2n = 40

R

V7300

MG, Brazil

 

Arachis pseudovillosa

2n = 20

R

V7695

MS, Brazil

Trierectoides

Arachis guaranitica

2n = 20

E

V13600

MS, Brazil

Triseminatae

Arachis triseminata

2n = 20

T

W 195

BA, Brazil

Abbreviations: As – Scariot, Ff – Ferreira, K - Krapovickas, Sv - Silva, V - Valls, W- Werneck

The existence of repeated sequences in microsatellite primer-amplified fragments for locus Ah11 of A. hypogaea and DNA of 18 species (A. batizocoi A. burkartii, A. cardenasii, A. decora, A. duranensis, A. guaranitica, A. hoehnei, A. hypogaea, A. ipaënsis, A. kempff-mercadoi, A. kuhlmannii, A. macedoi, A. magna, A. paraguariensis, A. repens, A. subcoriacea, A. triseminata and A. valida) was confirmed by sequencing. The sequences of the fragments of each species analyzed are shown in Figure 1. All species showed repeated sequences similar to those found in Ah11 locus of the cultivated peanut, regardless of the section to which the species belonged. These sequences differed from each other only in the number of repeated motifs. Thus, primers for A. hypogaea were able to amplify microsatellites in other Arachis species.

A neighbor-joining tree constructed based on a small part of the flanking regions and on the repeated sequences of the Ah11 locus in 18 species is shown in Figure 3. The species of the different sections of Arachis were scattered throughout the tree and some were located close to species from other sections. The majority of the variation among species reflected differences in the number of motifs among the species and not in the flanking regions. These results suggested that there was no correlation between the number of repeated sequences and the taxonomic relationship among these species, and that the level of information contained in a microsatellite locus did not necessarily positively correlate to the degree of relatedness to A. hypogaea. For instance, A. hoehnei and A. cardenasii, both from section Arachis, had shorter microsatellites than A. repens (Section Caulorrhizae) and A. triseminata (section Triseminatae). A larger number of plants from each species would need to be analyzed in order to test this hypothesis because microsatellites are highly polymorphic and the accessions of the species analyzed may have been extreme in the range of variation found at each analyzed locus.
Figure 3

Relationships among A. hypogaea and 17 Arachis (A. valida, A. triseminata, A. subcoreacea, A. cardenasii, A. guaranitica, A. batizocoi, A. repens, A. duranensis, A. paraguariensis, A. burkartii, A. ipaënsis, A. kuhlmanni, A. kempff-mercadoi, A. magna, A. hoehnei, A. decora, A. macedoi) species based on polymorphism found in the sequences amplified using primer pair Ah11.

An analysis of the cross-transferability of microsatellite loci in Vitaceae showed that microsatellite repeats were present in most of the species examined and that flanking sequences were conserved and could be used to examine evolutionary relationships [35]. The potential usefulness of flanking regions to assess taxonomic relationship in Arachis was not approached in this study. However, our results indicate that these regions could be useful for establishing genetic relationship in Arachis, since the relationship established based on amplification events (Figure 2), which depend on the conservation of the flanking regions, agreed with the division of the species of Arachis section into genomes A and B.

Some species had more than one fragment amplified using some primer pairs, including accessions of the diploid species A. simpsonii, A. aff. cardenasii, A. linearifolia, A. hermannii, and A. pseudovillosa, which showed more than one fragment using Ah21 (Table 4). These results suggested that the accessions of the above species were heterozygous. Arachis species were expected to be homozygous since they are considered to be autogamous simply by analogy to cultivated peanut [36]. In addition, these species are diploid, a fact that excludes the possibility of existence of two homozygous loci with different alleles, as observed for Ah21 and Ah30 in A. hypogaea, which is an allotetraploid (Table 3). The data suggested that cross-pollination happens in some Arachis species. Evidences of cross-pollination in A. duranensis were found when different accessions were analyzed using RFLP [37]. The extensive polymorphism detected within accessions of A. cardenasii using cDNA and seed storage proteins probes [5, 38, 39] has also been suggested to be related to high frequency of cross-pollination. As polymorphic codominant markers, microsatellites are useful tools to analyze the mating system of wild species of Arachis.
Table 4

PCR primer pairs used to amplify microsatellites in wild species of Arachis

Locus

Motifs

Primer sequences (5'-3')

Expected size (bp)

Annealing temperature (°C)

MgCl2mM

  

Forward

Reverse

   

Ah2

(AC)10

TTACACGGTAGCCCATTTCC

CCAAACCACAATTCAGTAGCAA

199

55

2.5

Ah3

(GA)15.(AG)7.(GT)7.(GA)7

TCGGAGAACAAGCACACATC

TTGCGCTCTTTCTCACACTC

202

55

1.5

Ah7

(TG)8

CAGAGTCTGTGATTTGTGCACTG

ACAGAGTCGGCCGTCAAGTA

102

55

1.5

Ah11

(TTA)15

AAATAATGGCATACTTGTGAACAATC

TTCCACCAAGGCAAGACTATG

176

55

2.5

Ah19

(TA)18

CCCTCGAAGGTGGAATTCAT

CGGGGATTGTTCGAGTTTG

197

55

2.5

Ah20

(TG)10

TGCATGTCTCTTGTAACTTAATACACT

TTCATGTCAATGATGTTTCCAA

197

55

2.5

Ah21

(GAA)9

CTTGGAGTGGAGGGATGAAA

CTCACTCACTCGCACCTAACC

109

55

1.5

Ah23

(AT)19

GAAGGTGGAATTCATTCTCAAAA

TTCGAGTTTGAACAACTGACG

183

55

2.0

Ah26

(CT)14

GAAAATGATGCCATAAAGCGTA

AGTGTAACACCCCGTTAGCC

182

55

2.0

Ah30

(GA)9

TGCTCTTCTTTTCCTTTTCAC

AACGGCCAAAACTGAAATTA

123

45

2.0

Ah51

(AG)34

CCTCTTCACAAGAGTGGACTATGA

CCCCCTCCTTTTGTTCTCTC

154

55

2.0

Ah6–125*

(GAA)13

TCGTGTTCCCGATTGTCC

GCTTTGAACATGAACATGCC

180

55

2.0

Ah126

(GA)8..(GA)9

CCCTGCCACTCTCACTCACT

CGTACAAGTCAGGGGGTGAC

187

60

1.5

Ah282

(CCA)6..(AAG)6

GCCAAACACACCACATTTCA

GGCTCCAATCCCAAACACTA

203

55

2.5

* Reference: Hopkins and colleagues [15].

Conclusion

These results show that microsatellite primer pairs of A. hypogaea have multiple uses. A higher level of variation among A. hypogaea accessions is detected using microsatellite markers in comparison to other markers, such as RFLP, RAPD and AFLP. The microsatellite primer pairs of A. hypogaea showed high transferability rate to other species of the genus. These primer pairs are useful tools to evaluate the genetic variability and to assess the mating system among Arachis species.

Methods

Plant material

Sixteen accessions of A. hypogaea and 38 accessions of species from eight of the nine sections of the genus Arachis were analyzed (Table 3). The samples were obtained from Arachis Germplasm Bank (EMBRAPA Recursos Genéticos e Biotecnologia – Brasília, DF, Brazil).

DNA extraction

DNA was extracted using the procedure of Grattapaglia and Sederoff [40]. The quality of the DNA was checked on 1% agarose gels and the DNA concentrations were estimated spectrophotometrically (Genesys 5 – Spectronic Instruments).

Library construction and primer design

Nine micrograms of genomic DNA from A. hypogaea were digested using 1.35 μl of HaeIII (10 U/μl), 2 μl of AluI (10 U/μl) and 1 μl of RsaI (10 U/μl) (New England Biolabs). The reaction products were electrophoresed on 1% low melting point agarose gels and fragments 200–600 bp in size were excised from the gel, extracted with phenol/chloroform, and ligated into pBluescript (Stratagene). The ligated clones were used to transform Escherichia coli XL1-blue MRF' (Stratagene). The library was amplified overnight at 30°C with shaking (300 rpm) and the plasmids then isolated by phenol extraction. The library was enriched for AC and AG repeats using a GeneTrapper® cDNA positive selection system (Invitrogen). The selected clones were used to transform XL1-blue MRF' bacterial cells. The white colonies were grown overnight in LB-liquid medium supplemented ampicillin (100 μg/ml). The plasmids were extracted using a Concert® rapid plasmid purification system (Invitrogen). Sequencing was done using T3 and T7 primers. The sequencing reaction mixture consisted of 2 μl of plasmid DNA, 2 μl of Big Dye terminator, 8 pmol of primer and water to a final volume of 10 μl. Sequencing was carried out in an ABI Prism 377 sequencer (Applied Biosystems). The primers were designed using Primer3 software [41].

PCR

Fourteen primer pairs were used for PCR amplification, being 13 designed using the sequences selected in the above step and one reported by Hopkins and colleagues [15] (Table 4). Each amplification reaction contained 1 U of Taq DNA polymerase (Invitrogen), 1 × amplification buffer (200 mM Tris pH 8.4, 500 mM KCl), 200 μM of each dNTP, 1.5–2.5 mM MgCl2 (Table 2), 0.2 μM of each primer, 15 ng genomic DNA, and water to a final volume of 17 μl. The following thermocycling conditions were used: 1 cycle: 94°C for 5 min, 35 cycles: 94°C for 30 s, × °C for 45 s and 72°C for 1 min, and a final cycle: 72°C for 10 min. The annealing temperatures (X) and MgCl2 concentrations were optimized for each pair of primers to allow amplification in the wild species. The amplifications were done in a PTC100 thermocycler (MJ Research).

Electrophoresis

The sequence variation in A. hypogaea and two wild diploid species (A. duranensis and A. ipaënsis) was analyzed using 4% denaturating polyacrylamide gels (19:1 acrylamide/bisacrylamide, 7 M urea) that were silver stained. The sizes of the fragments were estimated based on a 10 bp ladder (Invitrogen).

The PCR products obtained using DNA from wild species were electrophoresed on 3% metaphor (FMC Bioproducts) agarose gels for 3 h at 120 V. The agarose gels were stained with ethidium bromide and PCR products viewed under UV light. The size of fragments was estimated based on a 100 bp ladder (GE).

Analysis of variation in A. hypogaea

The allelic and genotypic frequencies were calculated for the samples analyzed. The genetic variability of the sample as a whole was estimated based on the number of alleles per locus (total number of alleles/number of loci), the percentage of polymorphic loci (number of polymorphic loci/total number of loci analyzed) and Polymorphism Information Content (PIC = 1 - i = 1 Pi 2 i = 1 j = i + 1 Pi 2 Pj 2 MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaqabeGadaaakeaadaaeqbqaaiabbcfaqjabbMgaPnaaCaaaleqabaGaeGOmaidaaaqaaiabbMgaPjabg2da9iabigdaXaqab0GaeyyeIuoakiabgkHiTmaaqafabaWaaabuaeaacqqGqbaucqqGPbqAdaahaaWcbeqaaiabikdaYaaakiabbcfaqjabbQgaQnaaCaaaleqabaGaeGOmaidaaaqaaiabbQgaQjabg2da9iabbMgaPjabgUcaRiabigdaXaqab0GaeyyeIuoaaSqaaiabbMgaPjabg2da9iabigdaXaqab0GaeyyeIuoaaaa@4B09@ ).

Analysis of the locus cross-species transferability

The cross-species transferability of eight loci was evaluated using 37 accessions of 37 species from eight sections of the genus Arachis. The percentage of transferability was calculated for each locus for section Arachis (22 species) and for the whole sample (37 species) as the number of species in which the expected fragment was detected/the total number of species analyzed. A binary matrix based on the amplification events for section Arachis alone was prepared based on the data in Table 4. In this matrix, 1 indicated amplification and 0, no amplification. A genetic distance matrix was calculated using the Nei and Li distance [42] and a dendrogram was constructed using the UPGMA method (unweighted pair group method with arithmetic mean) [43].

Sequencing of PCR products and sequence analysis

The PCR products obtained using the pair of primers for locus Ah11 and DNA of 18 species (A. batizocoi A. burkartii, A. cardenasii, A. decora, A. duranensis, A. guaranitica, A. hoehnei, A. hypogaea, A. ipaënsis, A. kempff-mercadoi, A. kuhlmannii, A. macedoi, A. magna, A. paraguariensis, A. repens, A. subcoriacea, A. triseminata and A. valida) were purified using the Concert® Rapid PCR purification system (Invitrogen). The sequencing reaction mixture had a total volume of 10 μl: 2 μl of purified PCR product, 2 μl of Big Dye Terminator, 6 pmol of one primer, and 5.4 μl of water. The sequencing cycle consisted of 25 cycles of 96°C for 45 s, 55°C for 55 s, and 60°C for 4 min. The reactions were run in a PTC 100 cycler (MJ Research) followed by sequencing in an ABI Prism 377 sequencer. The sequences were edited using the Sequencer program (version 3.1) (GeneCodes). Sequence alignment and a neighbor-joining tree were obtained using Clustal X (version 1.8) [44].

Declarations

Acknowledgements

We are grateful to FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo, SP – Brazil) for the financial support.

Authors’ Affiliations

(1)
Laboratório de Biotecnologia e Genética Molecular (BIOGEM), Departamento de Genética, Instituto de Biociências, Universidade Estadual Paulista (UNESP)
(2)
Instituto Agronômico de Campinas – RGV

References

  1. Krapovickas A, Gregory WC: Taxonomía del Género Arachis (Leguminosae). Bonplandia. 1994, 8: 1-186.Google Scholar
  2. French EC, Prine GM, Ocumpaugh WR, Rice RW: Regional Experience with Forage Arachis in the United States. Biology and Agronomy of Forage Arachis. Edited by: Kerridge PC, Hardy B. 1994, Cali: CIAT, 169-186.Google Scholar
  3. Valls JFM: Variability in the genus Arachis and potential forage uses. Identifying germplasm for successful forage legume-grass interactions. Edited by: Springer TL, Pittman RN. 1996, Washington: USDA-ARS, 15-27.Google Scholar
  4. Halward TM, Stalker HT, LaRue EA, Kochert G: Use of single primer DNA amplification in genetic studies of peanut. Plant Mol Biol. 1992, 18: 315-325. 10.1007/BF00034958.PubMedView ArticleGoogle Scholar
  5. Paik-Ro OG, Smith RL, Knaulf DA: Restriction fragment length polymorphism evaluation of six peanut species within the Arachis section. Theor Appl Genet. 1992, 84: 201-208. 10.1007/BF00224001.PubMedView ArticleGoogle Scholar
  6. He G, Prakash CS: Identification of polymorphic DNA markers in cultivated peanut (Arachis hypogaea L.). Euphytica. 1997, 97: 143-149. 10.1023/A:1002949813052.View ArticleGoogle Scholar
  7. Kochert G, Stalker HT, Gimenes M, Galgaro L, Lopes CR, Moore K: RFLP and cytogenetic evidence on the origin and evolution of allotetraploid domesticated peanut Arachis hypogaea (Leguminosae). Am J Bot. 1996, 83: 1282-1291. 10.2307/2446112.View ArticleGoogle Scholar
  8. Young ND, Weeden NF, Kochert G: Genome mapping in legumes (Family Fabaceae). Genome mapping in plants. Edited by: Paterson AH. 1996, Landes, 211-277.Google Scholar
  9. Kochert G, Halward T, Branch WD, Simpson CE: RFLP variability in peanut (Arachis hypogaea L.) cultivars and wild species. Theor Appl Genet. 1991, 81: 565-570. 10.1007/BF00226719.PubMedView ArticleGoogle Scholar
  10. Mörchen M, Cuguen J, Michaelis G, Hänni C, Saumitou-Laprade P: Abundance and length polymorphism of microsatellite repeats in Beta vulgaris L. Theor Appl Genet. 1996, 92: 326-333. 10.1007/s001220050131.PubMedView ArticleGoogle Scholar
  11. Jarret RL, Merrick LC, Holms T, Evans J, Aradhya MK: Simple sequence repeats in watermelon (Citrullus lanatus (Thunb.) Matsum. and Nakai). Genome. 1997, 40: 433-441.PubMedView ArticleGoogle Scholar
  12. Aguirre PC, Maya MM, Bonierbale MW, Kresovich S, Fregene MA, Tohme J, Kochert G: Microsatellites in Cassava (Manihot esculenta Crantz): Discovery inheritance and variability. Theor Appl Genet. 1998, 97: 493-501. 10.1007/s001220050922.View ArticleGoogle Scholar
  13. Riaz S, Dangl GS, Edwards KJ, Meredith CP: A microsatellite markers based framework linkage map of Vitis vinifera L. Theor Appl Genet. 2004, 108: 864-872. 10.1007/s00122-003-1488-5.PubMedView ArticleGoogle Scholar
  14. Lee JM, Nahm SH, Kim YM, Kim BD: Characterization and molecular genetic mapping of microsatellite loci in pepper. Theor Appl Genet. 2004, 108: 619-627. 10.1007/s00122-003-1467-x.PubMedView ArticleGoogle Scholar
  15. Hopkins MS, Casa AM, Wang T, Mitchell SE, Dean RE, Kochert GD, Kresovich S: Discovery and characterization of polymorphic simple sequence repeats (SSRs) in peanut. Crop Sci. 1999, 39: 1243-1247.View ArticleGoogle Scholar
  16. Ferguson ME, Burow MD, Schulze SR, Bramel PJ, Paterson AH, Kresovich S, Mitchell S: Microsatellite identification and characterization in peanut (A. hypogaea L.). Theor Appl Genet. 2004, 108: 1064-1070. 10.1007/s00122-003-1535-2.PubMedView ArticleGoogle Scholar
  17. Moretzsohn MC, Hopkins MS, Mitchell SE, Kresovich S, Valls JFM, Ferreira ME: Genetic diversity of peanut (Arachis hypogaea L.) and its wild relatives based on the analysis of hypervariable regions of the genome. BMC Plant Biol. 2004, 4: 11-10.1186/1471-2229-4-11.PubMed CentralView ArticleGoogle Scholar
  18. Galgaro ML, Lopes CR, Gimenes MA, Valls JFM, Kochert G: Genetic variation between several species of sections Extranervosae, Caulorrhizae, Heteranthae, and Triseminatae (genus Arachis) estimated by DNA polymorphism. Genome. 1998, 41: 445-454. 10.1139/gen-41-3-445.View ArticleGoogle Scholar
  19. Gimenes MA, Lopes CR, Galgaro ML, Valls JFM, Kochert G: RFLP analysis of genetic variation in species of section Arachis, genus Arachis (Leguminosae). Euphytica. 2002, 123: 421-429. 10.1023/A:1015033700110.View ArticleGoogle Scholar
  20. Subrahmanyam P, Ghanekar AM, Nolt BL, Reddy DVR, McDonald D: Resistance to groundnut diseases in wild Arachis species. Proceedings of the International Workshop on Cytogenetics of Arachis. Edited by: Moss JP. 1985, Patancheru: ICRISAT, 49-55.Google Scholar
  21. Katzir N, Danin-Poleg Y, Tzuri G, Karchi Z, Lavi U, Cregan PB: Length polymorphism and homologies of microsatellites in several Cucurbitaceae species. Theor Appl Genet. 1996, 93: 1282-1290. 10.1007/s001220050367.PubMedView ArticleGoogle Scholar
  22. Cordeiro GM, Casu R, McIntyre CL, Manners JM, Henry RJ: Microsatellite markers from sugarcane (Saccharum spp.) ESTs cross transferable to erianthus and sorghum. Plant Sci. 2001, 160: 1115-1123. 10.1016/S0168-9452(01)00365-X.PubMedView ArticleGoogle Scholar
  23. Korzun V, Malyshev S, Voylokov AV, Börner A: A genetic map of rye (Secale cereale L.) combining RFLP, isozyme, protein, microsatellite and gene loci. Theor Appl Genet. 2001, 102: 709-717. 10.1007/s001220051701.View ArticleGoogle Scholar
  24. Sourdille P, Tavaud M, Charmet G, Bernard M: Transferability of wheat microsatellites to diploid Triticeae species carrying the A, B and D genomes. Theor Appl Genet. 2001, 103: 346-352. 10.1007/s00122-001-0542-4.View ArticleGoogle Scholar
  25. Karagyozov L, Kalcheva ID, Chapman VM: Construction of random small-insert genomic libraries highly enriched for simple sequence repeats. Nucleic Acids Research. 1993, 21: 3911-3912. 10.1093/nar/21.16.3911.PubMedPubMed CentralView ArticleGoogle Scholar
  26. Kandpal RP, Kandpal G, Weissman SM: Construction of libraries enriched for sequence repeats and jumping clones, and hybridization selection for region-specific markers. Proceedings of the National Academy of Sciences of the USA. 1994, 91: 88-92. 10.1073/pnas.91.1.88.PubMedPubMed CentralView ArticleGoogle Scholar
  27. Cipriani G, Lot G, Huang W-G, Marrazo MT, Peterlunger E, Testolin R: AC/GT and AG/CT microsatellite repeats in peach [Prunus persica (L.) Batsch]: isolation, characterisation and cross-species amplification in Prunus. Theor Appl Genet. 1999, 99: 65-72. 10.1007/s001220051209.View ArticleGoogle Scholar
  28. He G, Meng R, Newman M, Gao G, Pittman RN, Prakash CS: Microsatellites as DNA markers in cultivated peanut (Arachis hypogaea L.). BMC Plant Biol. 2003, 3: 3-10.1186/1471-2229-3-3.PubMedPubMed CentralView ArticleGoogle Scholar
  29. Subramanian V, Gurtu S, Rao RCN, Nigam SN: Identification of DNA polymorphism in cultivated groundnut using random amplified polymorphic DNA (RAPD) assay. Genome. 2000, 43: 656-660. 10.1139/gen-43-4-656.PubMedView ArticleGoogle Scholar
  30. Gimenes MA, Lopes CR, Valls JFM: Genetic relationships among Arachis species based on AFLP. Gen Mol Biol. 2002, 25: 349-353.View ArticleGoogle Scholar
  31. Halward TM, Stalker HT, LaRue EA, Kochert G: Genetic variation detectable with molecular markers among unadapted germplasm resources of cultivated peanut and wild species. Genome. 1991, 34: 1013-1020.View ArticleGoogle Scholar
  32. Stalker HT: A new species in section Arachis of peanuts with a D genome. Am J Bot. 1991, 78: 630-637. 10.2307/2445084.View ArticleGoogle Scholar
  33. Tallury SP, Hilu KW, Milla SR, Friend SA, Alsaghir M, Stalker HT, Quandt D: Genomic affinities in Arachis section Arachis (Fabaceae): molecular and cytogenetic evidence. Theor Appl Genet. 2005, 111: 1229-1237. 10.1007/s00122-005-0017-0.PubMedView ArticleGoogle Scholar
  34. Moretzsohn MC, Leoi L, Proite K, Guimarães PM, Leal-Bertioli SCM, Gimenes MA, Martins WS, Valls JFM, Grattapaglia D, Bertioli DJ: A microsatellite-based, gene-rich linkage map for the AA genome of Arachis (Fabaceae). Theor Appl Genet. 2005, 111: 1060-1071. 10.1007/s00122-005-0028-x.PubMedView ArticleGoogle Scholar
  35. Rosseto M, McNally J, Henry RJ: Evaluating the potential of SSR flanking regions for examining taxonomic relationships in the Vitaceae. Theor Appl Genet. 2002, 104: 61-66. 10.1007/s001220200007.View ArticleGoogle Scholar
  36. Valls JFM, Pizarro EA: Collection of wild Arachis germplasm. Biology and Agronomy of Forage Arachis. Edited by: Kerridge PC, Hardy B. 1994, Cali: CIAT, 1-18.Google Scholar
  37. Stalker HT, Dhesi JS, Kochert G: Variation within the species Arachis duranensis Krap and W.C. Gregory a possible progenitor of cultivated peanut. Genome. 1995, 38: 1201-1212.PubMedView ArticleGoogle Scholar
  38. Bianchi-Hall CM, Keys RD, Stalker HT, Murphy JP: Diversity of seed storage protein pattern in wild peanut (Arachis, Fabaceae) species. Plant Syst Evol. 1993, 186: 1-15. 10.1007/BF00937710.View ArticleGoogle Scholar
  39. Lanham PG, Forster BP, McNicol P, Moss JP, Powell W: Seed storage protein variation in Arachis species. Genome. 1994, 37: 487-496.PubMedView ArticleGoogle Scholar
  40. Grattapaglia D, Sederoff RR: Genetic linkage maps of Eucalyptus grandis and Eucalyptus urophilla using a pseudo-testcross mapping strategy and RAPD markers. Genetics. 1994, 137: 1121-1137.PubMedPubMed CentralGoogle Scholar
  41. Rozen S, Skaletsky HJ: Primer3 on the WWW for general users and for biologist programmers. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Edited by: Krawetz S, Misener S. 2000, Totowa: Humana Press, 365-386.Google Scholar
  42. Nei M, Li WH: Mathemathical model for studying genetic variation in terms of restriction endonucleases. Proc Natl Acad Sci USA. 1979, 76: 5269-73. 10.1073/pnas.76.10.5269.PubMedPubMed CentralView ArticleGoogle Scholar
  43. Sokal RR, Rholf FJ: Biometry. New York: WH Freeman 1995.Google Scholar
  44. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 24: 4876-4882. 10.1093/nar/25.24.4876.View ArticleGoogle Scholar

Copyright

© Gimenes et al; licensee BioMed Central Ltd. 2007

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.