Production of haploids and doubled haploids in oil palm

  • Jim M Dunwell1Email author,

    Affiliated with

    • Mike J Wilkinson2Email author,

      Affiliated with

      • Stephen Nelson3,

        Affiliated with

        • Sri Wening4,

          Affiliated with

          • Andrew C Sitorus4,

            Affiliated with

            • Devi Mienanti4,

              Affiliated with

              • Yuzer Alfiko4,

                Affiliated with

                • Adam E Croxford2,

                  Affiliated with

                  • Caroline S Ford2,

                    Affiliated with

                    • Brian P Forster5 and

                      Affiliated with

                      • Peter DS Caligari3, 5, 6

                        Affiliated with

                        BMC Plant Biology201010:218

                        DOI: 10.1186/1471-2229-10-218

                        Received: 2 June 2010

                        Accepted: 7 October 2010

                        Published: 7 October 2010

                        Abstract

                        Background

                        Oil palm is the world's most productive oil-food crop despite yielding well below its theoretical maximum. This maximum could be approached with the introduction of elite F1 varieties. The development of such elite lines has thus far been prevented by difficulties in generating homozygous parental types for F1 generation.

                        Results

                        Here we present the first high-throughput screen to identify spontaneously-formed haploid (H) and doubled haploid (DH) palms. We secured over 1,000 Hs and one DH from genetically diverse material and derived further DH/mixoploid palms from Hs using colchicine. We demonstrated viability of pollen from H plants and expect to generate 100% homogeneous F1 seed from intercrosses between DH/mixoploids once they develop female inflorescences.

                        Conclusions

                        This study has generated genetically diverse H/DH palms from which parental clones can be selected in sufficient numbers to enable the commercial-scale breeding of F1 varieties. The anticipated step increase in productivity may help to relieve pressure to extend palm cultivation, and limit further expansion into biodiverse rainforest.

                        Background

                        Success of early F1 hybrid maize varieties exemplifies the advantages of heterosis [1]. The use of doubled haploids as parents for F1 variety production fully exploits this phenomenon and has enabled substantial yield improvements in several crops [2, 3]. This strategy was outlined with the first DH crop variety [4] and has led to H/DH production systems being described for > 250 species [5]. However, few of these protocols generate the large numbers of Hs/DHs needed for commercial breeding, with just three methods (androgenesis, wide crossing, gynogenesis [6]) routinely adopted for H/DH production in only 30 species [5]. The most important of these methods in widespread use in commercial breeding is the generation of haploids in maize via pollination with a haploid inducing line such as a 'Stock 6' derivative. Desire for a more generic H/DH production system to improve agricultural yields is increasing as population growth, climate change, biofuel demand and other land-use pressures intensify. Clearly, in any species the production of F1 varieties depends not only on the production of homozygous lines to act as parents, but also it requires an efficient method to intercross the parents. This latter procedure is relatively simple in species with an outcrossing breeding system, like maize or oil palm, compared with those with an inbreeding system like rice or wheat. Production of F1 hybrids has been achieved successfully in this category of crops (for example hybrid rice in China) but often requires a male sterility system.

                        Annually, oil palm (Elaeis guineensis) yields eight to ten times more oil per hectare than rapeseed or soybean [7, 8] and in 2008 generated 38.9 million tonnes of oil worldwide [9]. The area assigned to the crop expanded ~1.7 fold between 1997 (8.7 M ha) and 2007 (14.6 M ha) [9] with further increases forecast. Over this same period global production of palm oil increased ~2.2 fold from 18 to 38.9 Mt y-1. Thus, yield increases have been achieved predominantly by expansion of cultivated area and not through yield enhancement. This trend raises concerns over the ecological impact of felling rainforest to accommodate oil palm cultivation [10, 11] and has stimulated debate over strategies to limit further agricultural expansion [1214]. One option explored here is to use market forces to help address the problem. If F1 varieties could increase yields sufficiently to exceed demand, commodity prices would fall. This would discourage clear felling and simultaneously incentivise early replacement of existing plantations with high-yielding varieties. Feasibility of the approach clearly relies on the ability to gain marked improvements in yield. Current yields of oil palm (generally 4-10.5 t ha-1) [15, 16] are much lower than the most conservative estimates of the crop's potential (17 t ha-1 [14] to 60 t ha-1 [16]). Indeed, yields per hectare in the two largest producer countries (Indonesia and Malaysia) have remained static for 30 years [9]. It should be noted, however, that in both these countries there are examples of selected varieties with much higher yields, with the highest yields from commercial breeding trials already exceeding 10 t ha-1.

                        To date, a H/DH-derived F1 breeding approach has been precluded by the repeated failure to secure H/DHs via anther or microspore culture [17] and successful generation of H/DHs in oil palm is unreported in the literature. The report of a spontaneous H in the related coconut palm [18] and in other species [19] nevertheless gave hope that spontaneous Hs may also occur in oil palm. However, the characteristically rare occurrence of spontaneous H/DHs necessitates development of an effective high-throughput screening system. Phenotypic characteristics of H/DH (slow growth, altered flowering phenology, smaller stomata and smaller organs [5]) could be used for diagnosis but are difficult to score qualitatively on a large scale and require plants of a reasonable size. An alternative strategy is to seek undefined atypical phenotypic features that may arise from reduced cell size and/or the hemizygous state of haploid individuals (homozygous for DHs) and that are manifest at the seedling stage when high-throughput visual assessment is more plausible. A more directed approach is also possible. Spontaneous H/DH seedlings are often associated with aberrant germination features, such as twin embryos from the same carpel [20], providing a defined feature for phenotypic selection. Here, we combined a large-scale visual survey for undefined atypical palm seedling phenotypes coupled with active selection for seeds with twin embryos to assemble a sub-population of seedlings enriched for H/DHs.

                        Results

                        Over two years, we performed two large-scale screens for morphological 'off-types' among oil palm seedlings generated by the Bah Lias Research Station, Indonesia. The first screen utilised 10,900,000 seedlings from a wide range of crosses and identified 3,854 morphological 'off-types' (H/DH candidates), of which 53 had twin embryos and 3,801 were phenotypically abnormal (Figure 1). The second screen of approximately 10,000,000 seedlings from commercial seed production activities and approximately 1,000,000 seedlings from breeding experiments generated 5,704 H/DH candidates, of which 5,601 were phenotypically abnormal and 103 had twin embryos. More than 2,000 of these seedlings (including all those with twin embryos) were transferred to the nursery prior to further screening. Although Hs could be identified relatively easily on the basis of their reduced genome size, we initially wished to target the more difficult, but more valuable DHs to circumvent the need for chromosome doubling. For the second level screen, we exploited the fact that Hs and DHs would be either hemi- or homozygous across all loci; thus individuals exhibiting heterozygosity at any locus could be discarded. Applying this logic, we performed a sequential screen using 9-15 microsatellite markers (Table 1) on all individuals and found 117 seedlings that exhibited a single allele across all loci (Table 2). These individuals were retained as candidate H/DH, and subsequent flow cytometry of leaf samples identified 83 as H, and 34 as diploid (Table 2). The haploid status of six palms was further confirmed by cytological examination of intact cells from root squashes. Each contained the expected 16 chromosomes (Figure 2).
                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig1_HTML.jpg
                        Figure 1

                        Seed germination morphology for H/DH identification. a: normal; b: abnormal; c: twin embryo.

                        Table 1

                        Microsatellite primer pairs used to identify homozygous DH or hemizygous H candidates in the initial molecular screen.

                        No.

                        Forward primer (5'-3')

                        Reverse primer (5'-3')

                        1

                        GAGATTACAAAGTCCAAACC

                        TCAAAATTAAGAAAGTATGC

                        2

                        ACGCATGCAGCTAGCTTTTC

                        CGCGTGAAAGATATGAATCAAC

                        3

                        CACGCACGCAGTTTATTCTT

                        GGATGTATGCTTTACCTCCGAAT

                        4

                        CCCCTTTTGCTTCCCTATTT

                        CTCCTTTTCCCCATCACAGA

                        5

                        GACACAAGCAAAAACAAAAGCA

                        ATTCTGAAAGGAGGGGGAAA

                        6

                        ATATGTGTGGGTGTGCGTGT

                        TGCCTCTGGTTGTTAGTCTGG

                        7

                        TCTCTCTCTCTCTCTCTATGTGTGTGT

                        TGGCAATCAGCACACATTCT

                        8

                        GCAGCTCTTTCCACACCTCT

                        TGTGGTCTCCTGAGGAAGATG

                        9

                        TTTTCCCCATCACAGAATTG

                        CCCCTTTTGCTTCCCTATTT

                        10

                        TAGCCGCACTCCCACGAAGC

                        CCAGAATCATCAGACTCGGACAG

                        11

                        AGCTCTCATGCAAGTAAC

                        TTCAACATACCGTCTGTA

                        12

                        CCTTCAAGCAAAGATACC

                        GGCACCAAACACAGTAA

                        13

                        GTAGCTTGAACCTGAAA

                        AGAACCACCGGAGTTAC

                        14

                        GCTCGTTTTTGTTTAGGTGA

                        TTTTCTCCATAGTCCGTTAC

                        15

                        CCTCGGGTTATCCTTTTTACC

                        TGGCTGGCTTCGGTCTTAG

                        Markers 10-15 obtained from Billotte et al. [27].

                        Table 2

                        Results of ploidy analysis by flow cytometry of 117 candidate H/DH palms identified as both morphologically atypical and homozygous for the markers listed in Table 1.

                        Candidate

                        DNA sample code

                        No. markers used

                        Ploidy

                        50-Mix5-7

                        11260406301

                        9

                        x

                        50-03060367C

                        07280501801

                        15

                        x

                        50-03060260C-2

                        07280501901

                        15

                        x

                        53-03080954C-2

                        09270500101

                        10

                        x

                        53-03090761C-5

                        09280504501

                        10

                        x

                        BATCH 51;03060318C;1

                        060728_0010_01_a

                        15

                        x

                        BATCH 53;03090761C;5

                        060728_0018_01_a

                        15

                        x

                        0623/172;05095508C;1

                        060728_0021_01_a

                        15

                        x

                        BATCH 50;03060260C;2

                        060728_0027_01_a

                        15

                        x

                        0611/32;05050248C;1

                        060728_0032_01_a

                        15

                        x

                        0611/16;05050228C;1

                        060728_0034_01_a

                        15

                        x

                        BATCH 53;03080954C;2

                        060728_0035_01_a

                        15

                        x

                        06 412;04059061B;3

                        060728_0050_01_a

                        14

                        2x

                        0628/152;05100720C;1

                        060729_0021_01_a

                        15

                        x

                        0628/185;05100351C;1

                        060729_0063_01_a

                        15

                        x

                        BATCH 51;03060626C;1

                        060729_0127_02_a

                        15

                        x

                        BATCH 67;0409034MC;2

                        060729_0130_02_a

                        14

                        2x

                        BATCH 67;0409034MC;4

                        060729_0131_02_a

                        15

                        2x

                        BATCH 67;0409034MC;15

                        060729_0132_02_a

                        15

                        2x

                        BATCH 65;0409034MC;7

                        060729_0134_02_a

                        15

                        2x

                        BATCH 65;0409034MC;35

                        060729_0138_02_a

                        15

                        2x

                        BATCH 65;0409034MC;56

                        060729_0139_02_a

                        15

                        2x

                        BATCH 65;0409034MC;50

                        060729_0141_02_a

                        15

                        2x

                        BATCH 65;0409034MC;47

                        060729_0142_02_a

                        15

                        2x

                        0628/53;05090595C;1

                        060731_0043_01_a

                        15

                        x

                        0627/125;05090717C;2

                        060731_0065_01_a

                        15

                        x

                        0627/12;05080220C;1

                        060731_0080_01_a

                        15

                        x

                        0627/6;05080095C;1

                        060731_0086_01_a

                        14

                        x

                        0631/Normal;05039033B;31

                        060731_0265_01_a

                        14

                        x

                        64-0409021MC-34

                        02130604301

                        15

                        2x

                        64-0410040MC-1

                        02130604801

                        15

                        2x

                        51-03060626C

                        02130605301

                        15

                        x

                        64-0410040MC-20

                        02140600401

                        15

                        2x

                        64-0410040MC-16

                        02140600801

                        15

                        2x

                        65-0409021MC-2

                        02140601001

                        15

                        2x

                        06 412B-04059061B-3

                        02170605501

                        15

                        2x

                        06 412B-04129091B

                        02170605801

                        15

                        2x

                        0550-15/05010827C

                        02200602401

                        15

                        x

                        0550-17/05010442C-1

                        02200602601

                        15

                        x

                        0550-23/05020059C

                        02200603101

                        15

                        x

                        0550-33/05020568C

                        02200603401

                        15

                        x

                        0550-36/05020420C-2

                        02200603701

                        15

                        x

                        0550-40/05010880C

                        02200607501

                        14

                        x

                        0551-36/05020511C

                        02200607601

                        15

                        x

                        0551-32/05020361C-1

                        02210600401

                        15

                        x

                        0552-4/05010836C-2

                        02210600901

                        15

                        x

                        0552-38/05020501C

                        02210603101

                        14

                        x

                        0552-39/05020415C

                        02210603201

                        15

                        x

                        0552-31/05020858C

                        02210603701

                        15

                        x

                        0552-91/05020375C

                        02210603901

                        15

                        x

                        0552-111/05020626C

                        02210607201

                        15

                        x

                        0552-128/05020558C-1

                        02210607701

                        15

                        x

                        0601-35/05020946C

                        02210608201

                        15

                        x

                        0601-42/05030201C-6

                        02210609501

                        15

                        x

                        0601-51/05030224C-2

                        02220600201

                        15

                        x

                        0607-21/05040317C-3

                        02220601801

                        14

                        x

                        0606-32/05040240C

                        02220606201

                        13

                        x

                        0601-77/05020961C

                        02230600701

                        15

                        x

                        0601-62/05030147C

                        02230601401

                        15

                        x

                        0601-54/05030462C

                        02230601901

                        15

                        x

                        0551-21/05020271C-1

                        02200605801

                        14

                        x

                        0601-9/05020843C-2

                        02230603101

                        15

                        x

                        0602-17/05020631C-1

                        02230605501

                        15

                        x

                        0607-111/05040970C-1

                        03010600201

                        15

                        x

                        0607-81/05040578C-1

                        03010600501

                        15

                        x

                        0607-73/05040573C-1

                        03010605101

                        15

                        x

                        0607-89/05040748C-3

                        03010605501

                        15

                        x

                        0607-102/05050016C-2

                        03010606601

                        15

                        x

                        0608-15/05040519C-3

                        03010606901

                        15

                        x

                        0608-45/05041003C-1

                        03150603401

                        15

                        x

                        0610-60/05041024C-2

                        03150604401

                        15

                        x

                        0610-124/05055039C-1

                        03150604601

                        15

                        x

                        0609-54/05050089C-2

                        03150604701

                        15

                        x

                        0610-41/05050352C-1

                        03150606701

                        15

                        x

                        0609-58/05050255C-1

                        03220600201

                        15

                        x

                        0610-82/05050099C-2

                        03220601401

                        15

                        x

                        0610-77/05050353C-1

                        03220602701

                        15

                        x

                        0610-121/05055090C-1

                        03220603301

                        15

                        x

                        0610-81/05050099C-1

                        03220605901

                        15

                        x

                        0609-100/05055311C-1

                        03290600301

                        15

                        x

                        0610-11/05040938C-1

                        03290601101

                        15

                        x

                        0610-68/05050376C-3

                        03290602001

                        15

                        x

                        0610-58/05050344C-1

                        03290602201

                        15

                        x

                        0610-73/05050594C-3

                        03290603301

                        15

                        x

                        0611-84/05050714C-4

                        03290605001

                        15

                        x

                        0611-70/05050223C-1

                        03290606701

                        15

                        x

                        0611-73/05050351C-1

                        03290608001

                        15

                        x

                        0610-67/05050376C-2

                        04050600501

                        15

                        x

                        0610-40/05050102C-2

                        04050600901

                        15

                        x

                        0611-99/05050544C-1

                        04050602601

                        15

                        x

                        0611-110/05055011C-1

                        04050603601

                        15

                        x

                        0612-2/05050017C-1

                        04050609101

                        15

                        x

                        0612-70/05050530C-1

                        04050609201

                        15

                        x

                        0612-76/05050512C-1

                        04050610301

                        15

                        x

                        0611-109/05055144C-1

                        04120600101

                        15

                        x

                        0611-31/05050220C-1

                        04120600601

                        15

                        x

                        0611-38/05050284C-4

                        04120600901

                        15

                        x

                        0611-40/05050171C-1

                        04120601101

                        14

                        x

                        0612-80/05050713C-1

                        04120603101

                        15

                        x

                        65-0409034 MC-66

                        060829_0001_02_a

                        15

                        2x

                        65-0409034 MC-68

                        060829_0002_02_a

                        15

                        2x

                        65-0409034 MC-72

                        060829_0003_02_a

                        14

                        2x

                        65-0409034 MC-111

                        060829_0005_02_a

                        15

                        2x

                        65-0409034 MC-94

                        060829_0011_02_a

                        14

                        2x

                        65-0409034 MC-120

                        060829_0012_02_a

                        15

                        2x

                        65-0409034 MC-144

                        060829_0013_02_a

                        15

                        2x

                        65-0409034 MC-133

                        060829_0015_02_a

                        15

                        2x

                        65-0409034 MC-187

                        060829_0020_02_a

                        15

                        2x

                        65-0409034 MC-193

                        060829_0021_02_a

                        14

                        2x

                        65-0409034 MC-199

                        060829_0023_02_a

                        15

                        2x

                        65-0409034 MC-135

                        060829_0025_02_a

                        15

                        2x

                        65-0409034 MC-114

                        060829_0026_02_a

                        13

                        2x

                        65-0409034 MC-147

                        060829_0027_02_a

                        15

                        2x

                        65-0409034 MC-36 B

                        060829_0030_02_a

                        15

                        2x

                        65-0409034 MC-39 A

                        060829_0031_02_a

                        15

                        2x

                        65-0409034 MC-73 A

                        060829_0034_02_a

                        15

                        2x

                        65-0409034 MC-71 A

                        060829_0035_02_a

                        14

                        2x

                        Note: in this initial round, no DH was found. The DH (0644-219/05049582C) was detected in a subsequent batch.

                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig2_HTML.jpg
                        Figure 2

                        Chromosome spread of a haploid root cell from oil palm containing 16 C-metaphase chromosomes.

                        A larger-scale survey for heterozygosity was then performed using 97 additional microsatellites (Table 3) to confirm absolute hemizygosity of Hs and identify 'false' candidate DHs showing any heterozygosity. All Hs produced single-allele peak profiles across all microsatellites, thereby discounting fixed heterozygosity via locus duplication for all markers used. All diploids were heterozygous at several loci and so discarded. However, one diploid (0644-219/05049582C) identified from a later screen (see below) was homozygous across all 36 mapped loci found to be heterozygous in the maternal parent (palm number BL013/12-06). Taking account of linkage between mapped markers, the probability of such an individual occurring by chance following selfing was 8.72 × 10-8 (see Methods). This palm was therefore deemed a spontaneous DH.
                        Table 3

                        Microsatellite markers (described by Billotte et al. [27]) used for a larger-scale survey for hemizygosity of Hs and homozygosity of DH candidates previously identified by the morphological screen, microsatellite pre-screen (15 markers) and flow cytometry screen.

                        No.

                        Forward primer (5'-3')

                        Reverse primer (5'-3')

                        16

                        GACCTTTGTCAGCATACTTGGTGTG

                        GCAGGCCTGAAATCCCAAAT

                        17

                        ATGCATGTGATTTTATTAGGTGAGA

                        CGACCCTCAGTCAATCAGTAAG

                        18

                        AAGCTAGCGACCTATGATTTTAGA

                        AAACAAGTAATGTGCATAACCTTTC

                        19

                        CCCACCACCCCTAGCTTCTC

                        ACCCCGGTCCAAATAAAATC

                        20

                        AGAGAGAGAGAGTGCGTATG

                        GTCCCTGTGGCTGCTGTTTC

                        21

                        GGGTAGCAAACCTTGTATTA

                        ACTTCCATTGTCTCATTATTCT

                        22

                        CGAGGCCCAAAAACATTCAC

                        GGTCCCGATCCCGTCTACTG

                        23

                        TTGCGGCCCATCGTAATC

                        TCCCTGCAGTGTCCCTCTTT

                        24

                        AGGGAATTGGAAGAAAAGAAAG

                        TCCTGAGCTGGGGTGGTC

                        25

                        AGCAAGAGCAAGAGCAGAACT

                        CTTGGGGGCTTCGCTATC

                        26

                        TAGCCATGCCGCCACCACTT

                        CAATCCATTAGCGTGCCCTTCT

                        27

                        CTTACCCCGCCTCCTCTCCT

                        CGAAATGCCCTTCCTTTACACTA

                        28

                        CCTTATATCGCACGGGTTCC

                        TTCTTGGGGTCTCGCTACGG

                        29

                        GCAAGATGCAATGGAGTTCA

                        CAAACCGCAGCAAGTCAGA

                        30

                        GCAAAATTCAAAGAAAACTTA

                        CTGACAGTGCAGAAAATGTTATAGT

                        31

                        CGTTCATCCCACCACCTTTC

                        GCTGCGAGGCCACTGATAC

                        32

                        GAATGTGGCTGTAAATGCTGAGTG

                        AAGCCGCATGGACAACTCTAGTAA

                        33

                        ACATTCCCTCTATTATTCTCAC

                        GTTTTGTTTGGTATGCTTGT

                        34

                        AAGCCAACTTCACAGATATGTTGAT

                        ATGAGCCTAACAAAGCACATTCTAA

                        35

                        AGTGAGGTATGGTTGATTAGGA

                        TATTGATAGCATTTGGGATTAG

                        36

                        CTCCGATGGTCAAGTCAGA

                        AAATGGGGAAGGCAATAGTG

                        37

                        GCCGTTCAAGTCAATTAGAC

                        TTTGGGAGCAAGCATTATCA

                        38

                        TGCTTCTTGTCCTTGATACA

                        CCACGTCTACGAAATGATAA

                        39

                        CACCACATGAAGCAAGCAGT

                        CCTACCACAACCCCAGTCTC

                        40

                        TTTTATTTTCCCTCTCTTTTGA

                        ATTGCGTCTCTTTCCATTGA

                        41

                        CATATGGCGCACAGGCAC

                        GCAATACAAGAGCACCCAAAT

                        42

                        AGTTGGTTTGCTGATTTG

                        TGTTGCTTCTTTGATTTTC

                        43

                        GCTGAAGATGAAATTGATGTA

                        TTCAGGTCCACTTTCATTTA

                        44

                        ATGACCTAAAAATAAAATCTCAT

                        ACAGATCATGCTTGCTCACA

                        45

                        GGTGCAAGAGAGGAGGAATG

                        TTTGGTAGTCGGGCGTTTTA

                        46

                        GTTTGGCTTTGGACATG

                        TCCATCACAGGAGGTATAG

                        47

                        TGTTTTGTTTCGTGCATGTG

                        GGCTGACATGCAACACTAAC

                        48

                        CGGTTTTGTCGCATCTATG

                        GTCGTCAGGGAACAACAGT

                        49

                        CAATCATTGGCGAGAGA

                        CGTCACCTTTCAGGATATG

                        50

                        GAGCATGACGCAAACAAAGG

                        GCAACATGTTTGATGCATTAATAGTC

                        51

                        TCCAAGTAGCAAATGATGAC

                        TGCCCTGAAACCCTTGA

                        52

                        GAAGGGGCATTGGATTT

                        TACCTATTACAGCGAGAGTG

                        53

                        AACACTCCAGAAGCCAGGTC

                        GGTTTAGGTATTGGAACTGATAGAC

                        54

                        GATCCCAATGGTAAAGACT

                        AAGCCTCAAAAGAAGACC

                        55

                        TGTGGTTTGAGGCATCTTCT

                        GCCCACCAAAAGAAAGTAGT

                        56

                        TAGCCGCACTCCCACGAAGC

                        CCAGAATCATCAGACTCGGACAG

                        57

                        TCAAAGAGCCGCACAACAAG

                        ACTTTGCTGCTTGGTGACTTA

                        58

                        GGGGATGAGTTTGTTTGTTC

                        CCTGCTTGGCGAGATGA

                        59

                        TCTAATGCTCCCAAGGTACA

                        GGCTTGGTCCACGATCTT

                        60

                        AGCTCTCATGCAAGTAAC

                        TTCAACATACCGTCTGTA

                        61

                        TCCTCACTGCTCCTCTAATC

                        ACTCCCTATGGACCTTAGTC

                        62

                        AGGGAGGCGAACGAGAAACA

                        CGACTGCTGATGGGGAAGAG

                        63

                        CTACGGACTCACACCTATAT

                        ATGGTTCATCAATGAGATC

                        64

                        GTGAGCGATTGAGGGGTGTG

                        GGGGCTTGATTGAGTATTTCCA

                        65

                        AGGGCAAGTCATGTTTC

                        TATAAGGGCGAGGTATT

                        66

                        GAAGCCTGAGACCGCATAGA

                        TTCGGTGATGAAGATTGAAG

                        67

                        TTTCTTATGGCAATCACACG

                        GGAGGGCAGGAACAAAAAGT

                        68

                        GTTTATCATTTTGGGGTCAG

                        CGGTGTCCCTCAGGATGTA

                        69

                        CATGCACGTAAAGAAAGTGT

                        CCAAATGCACCCTAAGA

                        70

                        AATCCAAGTGGCCTACAG

                        CATGGCTTTGCTCAGTCA

                        71

                        TGTAGGTGGTGGTTAGG

                        TGTCAGACCCACCATTA

                        72

                        AGCAAGACACCATGTAGTC

                        GACACGTGGGATCTAGAC

                        73

                        AAAAGCCGATAGTGGGAACA

                        ATGCTGAGAGGTGGAAAATAGAG

                        74

                        GTCCATGTGCATAAGAGAG

                        CTCTTGGCATTTCAGATAC

                        75

                        AGCCAATGAAGGATAAAGG

                        CAAGCTAAAACCCCTAATC

                        76

                        CAATTCCAGCGTCACTATAG

                        AGTGGCAGTGGAAAAACAGT

                        77

                        GGGCTTTCATTTTCCACTAT

                        GCTCAACCTCATCCACAC

                        78

                        GACAGCTCGTGATGTAGA

                        GTTCTTGGCCGCTATAT

                        79

                        ACTTGTAAACCCTCTTCTCA

                        GTTTCATTACTTGGCTTCTG

                        80

                        CCTTCAAGCAAAGATACC

                        GGCACCAAACACAGTAA

                        81

                        CCACTGCTTCAAATTTACTAG

                        GCGTCCAAAACATAAATCAC

                        82

                        GGGAGAGGAAAAAATAGAG

                        CCTCCCTGAGACTGAGAAG

                        83

                        AGCAGGGCAAGAGCAATACT

                        TTCAGCAGCAGGAAACATC

                        84

                        GCCTATCCCCTGAACTATCT

                        TGCACATACCAGCAACAGAG

                        85

                        CATCAGAGCCTTCAAACTAC

                        AGCCTGAATTGCCTCTC

                        86

                        ATTCATTGCCATTCCCTTCA

                        TTGTCCCCTCTGTTCACTCA

                        87

                        ATTGCAGAGATGATGAGAAG

                        GAGATGCTGACAATGGTAGA

                        88

                        TCTCCCAAATCACTAGAC

                        ATCTGCAAGGCATATTC

                        89

                        ACGTTTTGGCAACTCTC

                        ACTCCCCTCTTTGACAT

                        90

                        TCCACTCTGGCAACTCC

                        AAGGATGGGCTTTGTAGT

                        91

                        TTTAGAGGACAAGGAGATAAG

                        CGACCGTGTCAAGAGTG

                        92

                        AGCAAAATGGCAAAGGAGAG

                        GGTGTGTGCTATGGAAGATCATAGT

                        93

                        GTAGCTTGAACCTGAAA

                        AGAACCACCGGAGTTAC

                        94

                        AAGCCACCAGGATCATC

                        GTCATTGCCACCTCTAACT

                        95

                        TTACTTGCTAAGCTCTCTAGC

                        TGGCTGTTTAATCTGTCTG

                        96

                        TCTATATTTGGTTGGCTTGA

                        ACTCATTTCAATCTCAGTGTC

                        97

                        TGCTACGTGCTGAAATA

                        ATTTCAGGTTCGCTTCA

                        98

                        CCTCCACTTCTCTTCATCTT

                        CTTCCTCAAGCTCAAACAAT

                        99

                        GATGTTGCCGCTGTTTG

                        CATCCCATTTCCCTCTT

                        100

                        ATGCTCCACCAAGTTTA

                        CACATCCTAGCATCATTG

                        101

                        AAGCAATATAGGTTCAGTTC

                        TCATTTTCTAATTCCAAACAAG

                        102

                        GCTCGTTTTTGTTTAGGTGA

                        TTTTCTCCATAGTCCGTTAC

                        103

                        CAGCACACAAATGACAT

                        CACCTTTCCTTTTTGTC

                        104

                        CCTATTCCTTACCTTTCTGT

                        GACTTACTATCTTGGCTCAC

                        105

                        CCTTGCATTCCACTATT

                        AGTTCTCAAGCCTCACA

                        106

                        CCTCCTTTGGAATTATG

                        GTGTTTGATGGGACATACA

                        107

                        ATTGGAGAGCACTTGGATAG

                        TTCTCTTCCTTCTCACTTGT

                        108

                        AGCCAGATGGAAATACAC

                        GTGCGATAAAGAGGAGAGT

                        109

                        TAGTTTTCCCATCACAGAGT

                        ACAATATTTAGACCTTCCATGAG

                        110

                        GTGCAGATGCAGATTATATG

                        CCTTTAGAATTGCCGTATC

                        111

                        ACAATAACCTGAGACAACAAGAAAC

                        ATACATCCCCTCCCCTCTCT

                        112

                        GAACTTGGCGTGTAACT

                        TGGTAGGTCTATTTGAGAGT

                        These initial screens collectively revealed 83 spontaneous Hs but no DHs (although one DH was discovered subsequently), with the undirected phenotypic 'off-type' selection proving substantially more effective than screening for twin embryos. This result suggests that our method could be used to secure large numbers of Hs but is less able to isolate DHs at useful frequencies. This finding, when coupled with the routine nature of H chromosome doubling in other crops [21], suggested the most promising route for commercial DH production lay in the isolation of Hs followed by somatic doubling. In subsequent screening of abnormal seedlings, high-throughput flow cytometry therefore replaced molecular analysis for candidate H identification. Haploid identity was then supported using at least 15 microsatellite markers. Plants identified as diploid by flow cytometry continued to be screened for DHs as above. Using this amended screening procedure, we have identified over 1,100 H palms from approximately 60 million seedlings (to July 2009).

                        To have maximum utility this H/DH material should encompass as much genetic diversity from within the breeding germplasm as possible. A Principal Coordinates Analysis performed on H profiles using 28 microsatellite loci showed the first two axes accounted for 58% of the detected variation. While most Hs had a strong affinity to commercial duras, Hs have also been generated from pisifera types and overall variability amongst Hs encompassed that seen for the entire commercial palm material (Figure 3).
                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig3_HTML.jpg
                        Figure 3

                        Principal Coordinates Analysis Plot of 95 diploid and 27 haploid palms based on 28 microsatellites. Red diamonds: haploids; green squares: commercial pisiferas; blue triangles: commercial teneras; yellow diamonds: commercial duras; purple diamonds: Ghanaian wild material. Microsatellite data in Table 7.

                        Effort then focussed on the creation of DHs from this rich germplasm of H genotypes (Figure 4). The most direct route to obtain DHs is to use chemical application to induce chromosome doubling. We applied a range of treatments to 50 H seedlings and screened leaves of the recovered material for evidence of chromosome doubling. Flow cytometry revealed that 48 seedlings contained substantial diploid sectors in their leaves; one palm was 100% doubled after exposure to10 mM colchicine (Figure 5) and 100 ppm GA3. To date, 16 H genotypes have produced pollen. This finding demonstrates scope for securing fertile gametes from diploid inflorescences or inflorescence sectors for DH or F1 production. Indeed, seed set using pollen from DH material has now been achieved (data not shown). Whilst further optimization work is required, our results when combined with experience in other crops [21] suggest routine production of fertile DH oil palm lines will be a relatively simple task.
                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig4_HTML.jpg
                        Figure 4

                        Selection of haploid oil palm plants growing in a nursery.

                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig5_HTML.jpg
                        Figure 5

                        Doubled haploid palm.

                        Discussion and Conclusions

                        The simple high-throughput phenotypic-genotypic seedling selection system used here provides a fourth practical approach to supplement androgenesis, wide crossing and gynogenesis [6] and has potential for many crops where H/DH production remains elusive. The prospect of adopting a similar untargeted approach more widely seems both plausible and attractive, and may be possible without experienced operators, especially as sophisticated phenomic screening systems [22] become more accessible.

                        In the case of oil palm, the efficacy of our H screening combined with the demonstrated ability to create DH palms, opens the way for the development of 100% true-breeding parental clones for F1 variety breeding. Thereafter, it is hoped that the potential genetic gain available from oil palm F1 hybrids will match that in other crops. If such a gain is achieved it could be beneficial in several ways. First, high-yielding F1 palms are likely to accelerate replacement of palms in existing plantations and cause a step-increase in production. Secondly, this breeding strategy provides greater flexibility for breeders to respond rapidly to emergent threats (e.g. climate change). Thirdly, using palm oil and its associated wastes for energy generation [7] could substantially reduce carbon-based emissions currently associated with the palm oil lifecycle [23]. Fourthly, DH oil palms could be exploited in combination with transgenic techniques that are now available for this crop [24]. Looking forward, the clear challenge is to maintain and improve oil palm productivity in the face of a changing climate sufficient to keep pace with growing demand [25]. However, it is important to point out that breeding is simply one stage in a long process from plantation to the eventual processed product and the economic realities of this international industry will finally determine the impact of any novel technology on the global agricultural system for this crop.

                        The provision here of a system for haploid-based F1 hybrid breeding in oil palm represents the first technological breakthrough likely to lead to step improvements in yield for this crop, and can also be applied to other crops recalcitrant to in vitro based H/DH systems. This methodology, in particular the application of high-throughput flow cytometry, has recently been applied successfully to two other tropical crops, namely rubber (Hevea brasiliensis L.) and cocoa (Theobroma cacao L.) (Nasution et al. unpublished).

                        Methods

                        Hs and DHs were identified using three methods: a morphological screen; homozygosity/hemizygosity assessment; and ploidy level measurement. Initial screens emphasized identification of candidate DHs where seedling morphology screening was followed by homozygosity/hemizygosity assessment using microsatellites. H/DHs were then distinguished by flow cytometry and DHs subjected to an extensive homozygosity screen (Figure 6). As spontaneous DH frequency was low, later screens emphasized H recovery where the morphological screen was followed by flow cytometry; homozygosity of candidate Hs was thereafter confirmed with microsatellites.
                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig6_HTML.jpg
                        Figure 6

                        Summary of stages for identification of haploid and doubled haploid palm.

                        Seed morphological screen

                        For seed storage, mesocarps were removed from freshly harvested seed, and seeds air-dried at ambient temperature (24 h). Seeds were thereafter stored at 25°C with 15-18% moisture content. To induce germination, stored seeds were re-hydrated over 3 d to 18-20% moisture content, followed by 38-40°C incubation (40-60 d). Seeds were then re-hydrated for a further 5 d to >22% moisture content, and air-dried at ambient temperature (4 h). Seeds were germinated at ambient temperature (7 d to 3 months after treatment) and examined for atypical germination morphology (Figure 1).

                        Molecular pre-screen to exclude heterozygotes

                        DNA was isolated from leaf tissue using DNeasy 96 Plant Kit (Qiagen, UK). Initial heterozygosity screens used 15 microsatellites (Table 1) yielding alleles readily distinguished by agarose gel electrophoresis (Figure 7). 10 μl PCR mixes comprised 1.0 μl 10× NH4 buffer (Bioline), 0.3 μl MgCl2 (10 mM), 0.4 μl dNTPs (10 mM), 0.2 μl each primer (10 mM), 1-5 ng DNA and 1U Taq polymerase (Bioline). Thermocycling conditions: 2 min at 94°C followed by 35 cycles of 94°C for 30 s, 52-58°C for 30 s and 72°C for 45 s, with a final extension of 72°C for 7 min. Candidates presenting two allelic bands after fractionation by (2-3% w/v metaphor) agarose gel electrophoresis were discarded.
                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig7_HTML.jpg
                        Figure 7

                        PCR amplicons generated by microsatellite marker 10 fractionated in 2% w/v agarose. Lanes 1-11 & 12-20: candidate H/DH palm plants; lane L: HyperladderI (Bioline, UK); lane 21: heterozygote control; lane 22: homozygote control. Candidates in lanes 1, 3, 4, 7, 8, 10, 11, 13, 16, 17, 19, 20 were deemed heterozygous and discarded.

                        Extended molecular screen

                        Candidate DHs and some Hs were subjected to an extensive assay for heterozygosity using 97 fluorescently-labelled microsatellites (Table 3) with 150 seedlings of normal phenotype and 24 heterozygous tenera palms as controls. PCR conditions were as described above and resultant products were fractionated on an ABI3730XL capillary sequencer (Applied Biosystems, USA) by Macrogen Inc (Korea). Allele size was determined (Genemapper v4.0) against a GS400HD standard. Individuals with two alleles at any locus were discarded.

                        DH candidate verification

                        To verify DH candidate 0644-219/05049582C we screened 212 microsatellites (Table 4) for heterozygosity in the maternal parent (BL013/12-06). 10 μl PCR mixes comprising: 5 μl BioMix™(Bioline, UK), 0.05 μl forward primer plus M13 adaptor (10 μM), 0.2 μl labelled M13(-29) (10 μM) (Sigma Genosys, UK), 0.2 μl reverse primer (10 μM) and 5-10 ng DNA were subjected to: 2 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 52°C, 45 s at 72°C, with a final extension of 72°C for 7 min. Amplicons were surveyed for heterozygosity by high-resolution melt (HRM) analysis according to Croxford et al. [26] using the candidate as the reference comparator. Samples with amplicons variable between the maternal parent and candidate DH were fractionated by capillary electrophoresis as above. 48 markers identified as heterozygous in the maternal parent (Table 5) were applied to the DH candidate to assess homozygosity.
                        Table 4

                        Microsatellite markers used to screen for heterozygosity on the maternal parent (palm BL013/12-06) of DH candidate palm (0644-219/05049582C).

                        No

                        Marker

                        Forward Primer (5'-3')

                        Reverse Primer (5'-3')

                        1

                        VS1

                        GAGATTACAAAGTCCAAACC

                        TCAAAATTAAGAAAGTATGC

                        2

                        OPSSR 3

                        ACGCATGCAGCTAGCTTTTC

                        CGCGTGAAAGATATGAATCAAC

                        3

                        OPSSR 7

                        CACGCACGCAGTTTATTCTT

                        GGATGTATGCTTTACCTCCGAAT

                        4

                        OPSSR 8

                        CCCCTTTTGCTTCCCTATTT

                        CTCCTTTTCCCCATCACAGA

                        5

                        OPSSR 9

                        GACACAAGCAAAAACAAAAGCA

                        ATTCTGAAAGGAGGGGGAAA

                        6

                        OPSSR 14

                        ATATGTGTGGGTGTGCGTGT

                        TGCCTCTGGTTGTTAGTCTGG

                        7

                        OPSSR 19

                        TCTCTCTCTCTCTCTCTATGTGTGTGT

                        TGGCAATCAGCACACATTCT

                        8

                        OPSSR 29

                        GCAGCTCTTTCCACACCTCT

                        TGTGGTCTCCTGAGGAAGATG

                        9

                        OPSSR 30

                        TTTTCCCCATCACAGAATTG

                        CCCCTTTTGCTTCCCTATTT

                        10

                        OPSSR32

                        GAACAAAACGGGAAGAAGCA

                        CCTCAAATGGGAGAAACCAG

                        11

                        mEgUWA07

                        CGGATAGAGGCAGCAAGACT

                        CTCGGGTTGTTTAACCCATT

                        12

                        mEgUWA44

                        TTGAGACGTCGTTCCTTTCC

                        AGCGGAGACCCAATAATCCT

                        13

                        mEgUWA50

                        CCTGCAACTGCAAATGAGAC

                        TCCAGACACAAACTACACACACC

                        14

                        mEgCIR0037

                        Published by Billotte et al. [27]

                        15

                        mEgCIR0055

                        Published by Billotte et al. [27]

                        16

                        mEgCIR0059

                        Published by Billotte et al. [27]

                        17

                        mEgCIR0067

                        Published by Billotte et al. [28]

                        18

                        mEgCIR0074

                        Published by Billotte et al. [27]

                        19

                        mEgCIR0146

                        Published by Billotte et al. [27]

                        20

                        mEgCIR0163

                        Published by Billotte et al. [27]

                        21

                        mEgCIR0173

                        Published by Billotte et al. [27]

                        22

                        mEgCIR0177

                        Published by Billotte et al. [27]

                        23

                        mEgCIR0192

                        Published by Billotte et al. [27]

                        24

                        mEgCIR0195

                        Published by Billotte et al. [27]

                        25

                        mEgCIR0243

                        Published by Billotte et al. [27]

                        26

                        mEgCIR0246

                        Published by Billotte et al. [27]

                        27

                        mEgCIR0257

                        Published by Billotte et al. [27]

                        28

                        mEgCIR0268

                        Published by Billotte et al. [27]

                        29

                        mEgCIR0328

                        Published by Billotte et al. [27]

                        30

                        mEgCIR0359

                        Published by Billotte et al. [27]

                        31

                        mEgCIR0366

                        Published by Billotte et al. [27]

                        32

                        mEgCIR0369

                        Published by Billotte et al. [27]

                        33

                        mEgCIR0380

                        Published by Billotte et al. [27]

                        34

                        mEgCIR0399

                        Published by Billotte et al. [27]

                        35

                        mEgCIR0408

                        Published by Billotte et al. [27]

                        36

                        mEgCIR0409

                        Published by Billotte et al. [27]

                        37

                        mEgCIR0425

                        Published by Billotte et al. [27]

                        38

                        mEgCIR0433

                        Published by Billotte et al. [27]

                        39

                        mEgCIR0439

                        Published by Billotte et al. [27]

                        40

                        mEgCIR0445

                        Published by Billotte et al. [27]

                        41

                        mEgCIR0446

                        Published by Billotte et al. [27]

                        42

                        mEgCIR0465

                        Published by Billotte et al. [27]

                        43

                        mEgCIR0521

                        Published by Billotte et al. [27]

                        44

                        mEgCIR0551

                        Published by Billotte et al. [27]

                        45

                        mEgCIR0555

                        Published by Billotte et al. [27]

                        46

                        mEgCIR0588

                        Published by Billotte et al. [27]

                        47

                        mEgCIR0772

                        Published by Billotte et al. [27]

                        48

                        mEgCIR0773

                        Published by Billotte et al. [27]

                        49

                        mEgCIR0774

                        Published by Billotte et al. [27]

                        50

                        mEgCIR0775

                        Published by Billotte et al. [27]

                        51

                        mEgCIR0778

                        Published by Billotte et al. [27]

                        52

                        mEgCIR0779

                        Published by Billotte et al. [27]

                        53

                        mEgCIR0781

                        Published by Billotte et al. [27]

                        54

                        mEgCIR0786

                        Published by Billotte et al. [27]

                        55

                        mEgCIR0787

                        Published by Billotte et al. [27]

                        56

                        mEgCIR0788

                        Published by Billotte et al. [27]

                        57

                        mEgCIR0790

                        Published by Billotte et al. [27]

                        58

                        mEgCIR0793

                        Published by Billotte et al. [27]

                        59

                        mEgCIR0800

                        Published by Billotte et al. [27]

                        60

                        mEgCIR0801

                        Published by Billotte et al. [27]

                        61

                        mEgCIR0802

                        Published by Billotte et al. [27]

                        62

                        mEgCIR0803

                        Published by Billotte et al. [27]

                        63

                        mEgCIR0804

                        Published by Billotte et al. [27]

                        64

                        mEgCIR0825

                        Published by Billotte et al. [27]

                        65

                        mEgCIR0827

                        Published by Billotte et al. [27]

                        66

                        mEgCIR0844

                        Published by Billotte et al. [27]

                        67

                        mEgCIR0874

                        Published by Billotte et al. [27]

                        68

                        mEgCIR0878

                        Published by Billotte et al. [27]

                        69

                        mEgCIR0882

                        Published by Billotte et al. [27]

                        70

                        mEgCIR0886

                        Published by Billotte et al. [27]

                        71

                        mEgCIR0894

                        Published by Billotte et al. [27]

                        72

                        mEgCIR0905

                        Published by Billotte et al. [27]

                        73

                        mEgCIR0906

                        Published by Billotte et al. [27]

                        74

                        mEgCIR0910

                        Published by Billotte et al. [27]

                        75

                        mEgCIR0912

                        Published by Billotte et al. [27]

                        76

                        mEgCIR1729

                        Published by Billotte et al. [27]

                        77

                        mEgCIR1740

                        Published by Billotte et al. [27]

                        78

                        mEgCIR1753

                        Published by Billotte et al. [27]

                        79

                        mEgCIR1773

                        Published by Billotte et al. [27]

                        80

                        mEgCIR1917

                        Published by Billotte et al. [27]

                        81

                        mEgCIR1977

                        Published by Billotte et al. [27]

                        82

                        mEgCIR1996

                        Published by Billotte et al. [27]

                        83

                        mEgCIR2110

                        Published by Billotte et al. [27]

                        84

                        mEgCIR2144

                        Published by Billotte et al. [27]

                        85

                        mEgCIR2149

                        Published by Billotte et al. [27]

                        86

                        mEgCIR2188

                        Published by Billotte et al. [27]

                        87

                        mEgCIR2212

                        Published by Billotte et al. [27]

                        88

                        mEgCIR2215

                        Published by Billotte et al. [27]

                        89

                        mEgCIR2380

                        Published by Billotte et al. [27]

                        90

                        mEgCIR2387

                        Published by Billotte et al. [27]

                        91

                        mEgCIR2414

                        Published by Billotte et al. [27]

                        92

                        mEgCIR2417

                        Published by Billotte et al. [27]

                        93

                        mEgCIR2422

                        Published by Billotte et al. [27]

                        94

                        mEgCIR2423

                        Published by Billotte et al. [27]

                        95

                        mEgCIR2427

                        Published by Billotte et al. [27]

                        96

                        mEgCIR2436

                        Published by Billotte et al. [27]

                        97

                        mEgCIR2440

                        Published by Billotte et al. [27]

                        98

                        mEgCIR2492

                        Published by Billotte et al. [27]

                        99

                        mEgCIR2518

                        Published by Billotte et al. [27]

                        100

                        mEgCIR2525

                        Published by Billotte et al. [27]

                        101

                        mEgCIR2569

                        Published by Billotte et al. [27]

                        102

                        mEgCIR2575

                        Published by Billotte et al. [27]

                        103

                        mEgCIR2577

                        Published by Billotte et al. [27]

                        104

                        mEgCIR2590

                        Published by Billotte et al. [27]

                        105

                        mEgCIR2595

                        Published by Billotte et al. [27]

                        106

                        mEgCIR2600

                        Published by Billotte et al. [27]

                        107

                        mEgCIR2621

                        Published by Billotte et al. [27]

                        108

                        mEgCIR2628

                        Published by Billotte et al. [27]

                        109

                        mEgCIR2763

                        Published by Billotte et al. [27]

                        110

                        mEgCIR2813

                        Published by Billotte et al. [27]

                        111

                        mEgCIR2860

                        Published by Billotte et al. [27]

                        112

                        mEgCIR2887

                        Published by Billotte et al. [27]

                        113

                        mEgCIR2893

                        Published by Billotte et al. [27]

                        114

                        mEgCIR3040

                        Published by Billotte et al. [27]

                        115

                        mEgCIR3111

                        Published by Billotte et al. [27]

                        116

                        mEgCIR3160

                        Published by Billotte et al. [27]

                        117

                        mEgCIR3194

                        Published by Billotte et al. [27]

                        118

                        mEgCIR3213

                        Published by Billotte et al. [27]

                        119

                        mEgCIR3232

                        Published by Billotte et al. [27]

                        120

                        mEgCIR3295

                        Published by Billotte et al. [27]

                        121

                        mEgCIR3296

                        Published by Billotte et al. [27]

                        122

                        mEgCIR3297

                        Published by Billotte et al. [27]

                        123

                        mEgCIR3298

                        Published by Billotte et al. [27]

                        124

                        mEgCIR3300

                        Published by Billotte et al. [27]

                        125

                        mEgCIR3301

                        Published by Billotte et al. [27]

                        126

                        mEgCIR3305

                        Published by Billotte et al. [27]

                        127

                        mEgCIR3307

                        Published by Billotte et al. [27]

                        128

                        mEgCIR3310

                        Published by Billotte et al. [27]

                        129

                        mEgCIR3311

                        Published by Billotte et al. [27]

                        130

                        mEgCIR3316

                        Published by Billotte et al. [27]

                        131

                        mEgCIR3321

                        Published by Billotte et al. [27]

                        132

                        mEgCIR3328

                        Published by Billotte et al. [27]

                        133

                        mEgCIR3350

                        Published by Billotte et al. [27]

                        134

                        mEgCIR3384

                        Published by Billotte et al. [27]

                        135

                        mEgCIR3389

                        Published by Billotte et al. [27]

                        136

                        mEgCIR3399

                        Published by Billotte et al. [27]

                        137

                        mEgCIR3400

                        Published by Billotte et al. [27]

                        138

                        mEgCIR3402

                        Published by Billotte et al. [27]

                        139

                        mEgCIR3427

                        Published by Billotte et al. [27]

                        140

                        mEgCIR3428

                        Published by Billotte et al. [27]

                        141

                        mEgCIR3433

                        Published by Billotte et al. [27]

                        142

                        mEgCIR3439

                        Published by Billotte et al. [27]

                        143

                        mEgCIR3477

                        Published by Billotte et al. [27]

                        144

                        mEgCIR3519

                        Published by Billotte et al. [27]

                        145

                        mEgCIR3526

                        Published by Billotte et al. [27]

                        146

                        mEgCIR3533

                        Published by Billotte et al. [27]

                        147

                        mEgCIR3534

                        Published by Billotte et al. [27]

                        148

                        mEgCIR3535

                        Published by Billotte et al. [27]

                        149

                        mEgCIR3538

                        Published by Billotte et al. [27]

                        150

                        mEgCIR3543

                        Published by Billotte et al. [27]

                        151

                        mEgCIR3544

                        Published by Billotte et al. [27]

                        152

                        mEgCIR3546

                        Published by Billotte et al. [27]

                        153

                        mEgCIR3555

                        Published by Billotte et al. [27]

                        154

                        mEgCIR3557

                        Published by Billotte et al. [27]

                        155

                        mEgCIR3563

                        Published by Billotte et al. [27]

                        156

                        mEgCIR3567

                        Published by Billotte et al. [27]

                        157

                        mEgCIR3569

                        Published by Billotte et al. [27]

                        158

                        mEgCIR3574

                        Published by Billotte et al. [27]

                        159

                        mEgCIR3587

                        Published by Billotte et al. [27]

                        160

                        mEgCIR3590

                        Published by Billotte et al. [27]

                        161

                        mEgCIR3592

                        Published by Billotte et al. [27]

                        162

                        mEgCIR3593

                        Published by Billotte et al. [27]

                        163

                        mEgCIR3607

                        Published by Billotte et al. [27]

                        164

                        mEgCIR3622

                        Published by Billotte et al. [27]

                        165

                        mEgCIR3633

                        Published by Billotte et al. [27]

                        166

                        mEgCIR3639

                        Published by Billotte et al. [27]

                        167

                        mEgCIR3643

                        Published by Billotte et al. [27]

                        168

                        mEgCIR3649

                        Published by Billotte et al. [27]

                        169

                        mEgCIR3653

                        Published by Billotte et al. [27]

                        170

                        mEgCIR3655

                        Published by Billotte et al. [27]

                        171

                        mEgCIR3663

                        Published by Billotte et al. [27]

                        172

                        mEgCIR3668

                        Published by Billotte et al. [27]

                        173

                        mEgCIR3672

                        Published by Billotte et al. [27]

                        174

                        mEgCIR3683

                        Published by Billotte et al. [27]

                        175

                        mEgCIR3684

                        Published by Billotte et al. [27]

                        176

                        mEgCIR3691

                        Published by Billotte et al. [27]

                        177

                        mEgCIR3693

                        Published by Billotte et al. [27]

                        178

                        mEgCIR3696

                        Published by Billotte et al. [27]

                        179

                        mEgCIR3698

                        Published by Billotte et al. [27]

                        180

                        mEgCIR3705

                        Published by Billotte et al. [27]

                        181

                        mEgCIR3711

                        Published by Billotte et al. [27]

                        182

                        mEgCIR3716

                        Published by Billotte et al. [27]

                        183

                        mEgCIR3718

                        Published by Billotte et al. [27]

                        184

                        mEgCIR3722

                        Published by Billotte et al. [27]

                        185

                        mEgCIR3727

                        Published by Billotte et al. [27]

                        186

                        mEgCIR3728

                        Published by Billotte et al. [27]

                        187

                        mEgCIR3732

                        Published by Billotte et al. [27]

                        188

                        mEgCIR3737

                        Published by Billotte et al. [27]

                        189

                        mEgCIR3739

                        Published by Billotte et al. [27]

                        190

                        mEgCIR3745

                        Published by Billotte et al. [27]

                        191

                        mEgCIR3747

                        Published by Billotte et al. [27]

                        192

                        mEgCIR3750

                        Published by Billotte et al. [27]

                        193

                        mEgCIR3755

                        Published by Billotte et al. [27]

                        194

                        mEgCIR3766

                        Published by Billotte et al. [27]

                        195

                        mEgCIR3769

                        Published by Billotte et al. [27]

                        196

                        mEgCIR3775

                        Published by Billotte et al. [27]

                        197

                        mEgCIR3782

                        Published by Billotte et al. [27]

                        198

                        mEgCIR3785

                        Published by Billotte et al. [27]

                        199

                        mEgCIR3787

                        Published by Billotte et al. [27]

                        200

                        mEgCIR3788

                        Published by Billotte et al. [27]

                        201

                        mEgCIR3792

                        Published by Billotte et al. [27]

                        202

                        mEgCIR3807

                        Published by Billotte et al. [27]

                        203

                        mEgCIR3808

                        Published by Billotte et al. [27]

                        204

                        mEgCIR3809

                        Published by Billotte et al. [27]

                        205

                        mEgCIR3813

                        Published by Billotte et al. [27]

                        206

                        mEgCIR3819

                        Published by Billotte et al. [27]

                        207

                        mEgCIR3825

                        Published by Billotte et al. [27]

                        208

                        mEgCIR3826

                        Published by Billotte et al. [27]

                        209

                        mEgCIR3828

                        Published by Billotte et al. [27]

                        210

                        mEgCIR3847

                        Published by Billotte et al. [27]

                        211

                        mEgCIR3850

                        Published by Billotte et al. [27]

                        212

                        mEgCIR3869

                        Published by Billotte et al. [27]

                        Table 5

                        Markers shown to be heterozygous in the maternal parent (palm BL013/12-06) and homozygous in the DH candidate (0644-219/05049582C).

                        No

                        Marker

                        Linkage Group

                        1

                        mEgCIR0268

                        1

                        2

                        mEgCIR0874

                        1

                        3

                        mEgCIR3847

                        1

                        4

                        mEgCIR2149

                        2

                        5

                        mEgCIR2518

                        3

                        6

                        mEgCIR0425

                        3

                        7

                        mEgCIR3544

                        3

                        8

                        mEgCIR3716

                        4

                        9

                        mEgCIR1917

                        4

                        10

                        mEgCIR3535

                        4

                        11

                        mEgCIR3310

                        4

                        12

                        mEgCIR3705

                        4

                        13

                        mEgCIR3477

                        4

                        14

                        mEgCIR0059

                        4

                        15

                        mEgCIR3557

                        4

                        16

                        mEgCIR2813

                        5

                        17

                        mEgCIR3543

                        6

                        18

                        mEgCIR0195

                        6

                        19

                        mEgCIR0894

                        7

                        20

                        mEgCIR0905b

                        7

                        21

                        mEgCIR0774

                        8

                        22

                        mEgCIR2440

                        8

                        23

                        mEgCIR0825

                        10

                        24

                        mEgCIR3826

                        10

                        25

                        mEgCIR0788

                        10

                        26

                        mEgCIR2628

                        10

                        27

                        mEgCIR0146

                        10

                        28

                        mEgCIR0878

                        11

                        29

                        mEgCIR1773

                        12

                        30

                        mEgCIR3311

                        12

                        31

                        mEgCIR0779

                        14

                        32

                        mEgCIR0588

                        14

                        33

                        mEgCIR3737

                        15

                        34

                        mEgCIR3850

                        15

                        35

                        mEgCIR3639

                        16

                        36

                        mEgCIR0905a

                        16

                        37

                        mEgCIR3739

                        unlinked

                        38

                        mEgCIR3160

                        unmapped

                        39

                        mEgCIR3360

                        unmapped

                        40

                        mEgCIR0801

                        unmapped

                        41

                        mEgCIR2577

                        unmapped

                        42

                        OPSSR14

                        unmapped

                        43

                        OPSSR30

                        unmapped

                        44

                        OPSSR32

                        unmapped

                        45

                        mEgUWA44

                        unmapped

                        46

                        mEgUWA50

                        unmapped

                        47

                        mEgUWA07

                        unmapped

                        48

                        VS1

                        unmapped

                        Linkage group assigned according to Billotte et al. [27].

                        DH candidate 0644-219/05049582C was found to be homozygous across all 48 loci that were heterozygous in its maternal parent. Of these 48 loci, 36 have been mapped by Billotte et al. [27] (Table 5). We first considered the probability of obtaining the observed homozygosity levels via independent assortment using only the unlinked markers from this group. For unlinked loci, the probability of homozygous offspring arising by independent assortment is 0.5 per locus. Given that heterozygous loci were secured from 14 of the 16 linkage groups, with the addition of a further unlinked (unassigned) marker, the probability of these markers all becoming homozygous by chance is therefore: P = 0.515 = 0.000030517578125.

                        This figure was further reduced by the inclusion of the remaining 21 markers that had been assigned a map position [27]. Here, linkage was accommodated by multiplying by 1-(distance in cM/100). Thus the inclusion of a new marker 10 cM from an existing marker would mean multiplying the cumulative total by 1- (10/100) = 1-0.1 = 0.9 (rather than 0.5 for an unlinked marker). This reduced the probability as follows:
                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Equa_HTML.gif

                        Flow Cytometry

                        Newly matured leaflets or radicles from candidate H/DH palms were subjected to flow cytometry according to Anumaganathan & Earle [29] to establish ploidy level. Commercial tenera palms were included as diploid controls. For high-throughput mass screening, tissue samples were bulked at a rate of five individual tissue samples per bulk. Bulked samples (about 0.5 cm2 for radicles and 1 cm2 for leaf material (per each individual) were sliced by chopping with a sharp clean razor-blade (20-30 chops), in a plastic 9 cm diameter Petri dish containing 1.5 ml of cold (5°C) CyStain® UV Ploidy solution (Partec, Germany) modified by addition of 6.48 mM dithiothreitol (DTT) and 1% (v/v) polyvinylpyrrolidone (PVP-40) (Sigma-Aldrich, USA). The addition of DTT and PVP-40 were found to reduce background counts ('noise') in output histograms of particle fluorescence in the analyte.

                        Confirmation of Hs by chromosome squashes

                        Harvested roots were pre-treated in iced water (24 h), then fixed in 3:1 v/v alcohol: glacial acetic acid at 4°C (24 h). They were then rinsed in water, softened in 1N HCl (20 min), rinsed in water (2 min) and stained in saturated aceto-orcein (1 min). The root tip was then squashed, mounted onto a glass slide, and examined using a compound photomicroscope.

                        Principal Coordinates Analysis

                        The genetic affinity of 270 Hs was compared with 95 representative diploids (Table 6) using 28 microsatellites (Table 7) by Principal Coordinates Analysis (PCoA). The PCoA was constructed using GenAlEx v6 [30]. Genetic distance option 'codominant-genotypic' was applied, where pairwise, individual-by-individual (N × N) genetic distances are calculated for codominant data. For a single-locus analysis, with i-th, j-th, k-th and l-th different alleles, a set of squared distances is defined as d 2(ii, ii) = 0, d 2(ij, ij) = 0, d 2(ii, ij) = 1, d 2(ij, ik) = 1, d 2(ij, kl) = 2, d 2(ii, jk) = 3, and d 2(ii, jj) = 4. The algorithm used in GenAlEx is based on Orloci [31] using distance matrix with standardization (by dividing the distance inputs by the square root of n-1). Here, Hs were treated as the DHs they were assumed to generate; thus genotypes were homozygous not hemizygous.
                        Table 6

                        Identification codes, oil palm type and ploidy level of oil palm genotypes used in the Principal Coordinates Analysis

                        No

                        Label no in PCO

                        Sample name in PCO

                        Palm Id

                        Ploidy level

                        1

                        1

                        haploid

                        05020271_0001

                        x

                        2

                        2

                        haploid

                        05050099_0001

                        x

                        3

                        3

                        haploid

                        05050099_0002

                        x

                        4

                        4

                        haploid

                        05020961_0001

                        x

                        5

                        5

                        haploid

                        05020511_0001

                        x

                        6

                        6

                        haploid

                        05020946_0001

                        x

                        7

                        8

                        haploid

                        05030147_0001

                        x

                        8

                        9

                        haploid

                        05030462_0001

                        x

                        9

                        10

                        haploid

                        05020420_0002

                        x

                        10

                        11

                        haploid

                        05020361_0001

                        x

                        11

                        12

                        haploid

                        05030060_0001

                        x

                        12

                        13

                        haploid

                        05020558_0001

                        x

                        13

                        14

                        haploid

                        05020631_0001

                        x

                        14

                        15

                        haploid

                        05040748_0003

                        x

                        15

                        16

                        haploid

                        05030308_0001

                        x

                        16

                        18

                        haploid

                        05080318_0003

                        x

                        17

                        19

                        haploid

                        06020186_0001

                        x

                        18

                        20

                        haploid

                        05110212_0001

                        x

                        19

                        21

                        haploid

                        05120555_0001

                        x

                        20

                        22

                        haploid

                        06011022_0001

                        x

                        21

                        23

                        haploid

                        05020059_0001

                        x

                        22

                        24

                        haploid

                        06020320_0004

                        x

                        23

                        25

                        haploid

                        06020571_0004

                        x

                        24

                        26

                        haploid

                        06020381_0001

                        x

                        25

                        27

                        haploid

                        05060119_0001

                        x

                        26

                        28

                        haploid

                        05090172_0001

                        x

                        27

                        30

                        haploid

                        05100321_0001

                        x

                        28

                        31

                        haploid

                        06010670_0006

                        x

                        29

                        32

                        haploid

                        06010842_0004

                        x

                        30

                        33

                        haploid

                        05050228_0001

                        x

                        31

                        34

                        haploid

                        05110260_0001

                        x

                        32

                        35

                        haploid

                        05110260_0002

                        x

                        33

                        36

                        haploid

                        05110162_0001

                        x

                        34

                        37

                        haploid

                        05101030_0001

                        x

                        35

                        38

                        haploid

                        05040273_0001

                        x

                        36

                        39

                        haploid

                        05110003_0001

                        x

                        37

                        40

                        haploid

                        05120002_0001

                        x

                        38

                        41

                        haploid

                        05080095_0001

                        x

                        39

                        43

                        haploid

                        06110122_0002

                        x

                        40

                        44

                        haploid

                        05110716_0001

                        x

                        41

                        45

                        haploid

                        05010836_0001

                        x

                        42

                        46

                        haploid

                        05120155_0001

                        x

                        43

                        47

                        haploid

                        05110875_0001

                        x

                        44

                        48

                        haploid

                        05070553_0001

                        x

                        45

                        49

                        haploid

                        05070466_0001

                        x

                        46

                        50

                        haploid

                        06010650_0001

                        x

                        47

                        51

                        haploid

                        05110718_0001

                        x

                        48

                        52

                        haploid

                        05110496_0001

                        x

                        49

                        53

                        haploid

                        06010107_0001

                        x

                        50

                        54

                        haploid

                        05120429_0002

                        x

                        51

                        55

                        haploid

                        06010953_0001

                        x

                        52

                        56

                        haploid

                        05030686_0001

                        x

                        53

                        57

                        haploid

                        05060107_0001

                        x

                        54

                        58

                        haploid

                        05030791_0001

                        x

                        55

                        59

                        haploid

                        05080585_0001

                        x

                        56

                        60

                        haploid

                        05020375_0001

                        x

                        57

                        61

                        haploid

                        05121048_0001

                        x

                        58

                        62

                        haploid

                        05055090_0001

                        x

                        59

                        63

                        haploid

                        05121004_0002

                        x

                        60

                        64

                        haploid

                        06030064_0001

                        x

                        61

                        65

                        haploid

                        05121061_0004

                        x

                        62

                        66

                        haploid

                        05060276_0001

                        x

                        63

                        67

                        haploid

                        05100988_0001

                        x

                        64

                        68

                        haploid

                        05060315_0001

                        x

                        65

                        69

                        haploid

                        06030324_0003

                        x

                        66

                        70

                        haploid

                        05080506_0001

                        x

                        67

                        71

                        haploid

                        06010813_0001

                        x

                        68

                        72

                        haploid

                        05110881_0001

                        x

                        69

                        73

                        haploid

                        05100717_0001

                        x

                        70

                        74

                        haploid

                        06020169_0009

                        x

                        71

                        75

                        haploid

                        05110134_0001

                        x

                        72

                        76

                        haploid

                        05030196_0001

                        x

                        73

                        77

                        haploid

                        05050220_0001

                        x

                        74

                        78

                        haploid

                        06011195_0001

                        x

                        75

                        79

                        haploid

                        05120725_0001

                        x

                        76

                        80

                        haploid

                        05100510_0001

                        x

                        77

                        81

                        haploid

                        05060624_0001

                        x

                        78

                        82

                        haploid

                        05060712_0001

                        x

                        79

                        83

                        haploid

                        05030150_0001

                        x

                        80

                        84

                        haploid

                        06030180_0001

                        x

                        81

                        85

                        haploid

                        06020915_0001

                        x

                        82

                        86

                        haploid

                        05101150_0003

                        x

                        83

                        87

                        haploid

                        05101152_0001

                        x

                        84

                        88

                        haploid

                        05020415_0001

                        x

                        85

                        89

                        haploid

                        05040029_0002

                        x

                        86

                        90

                        haploid

                        05040035_0003

                        x

                        87

                        91

                        haploid

                        06020573_0001

                        x

                        88

                        93

                        haploid

                        05121112_0008

                        x

                        89

                        94

                        haploid

                        05090078_0001

                        x

                        90

                        95

                        haploid

                        05060495_0001

                        x

                        91

                        96

                        haploid

                        05070484_0001

                        x

                        92

                        97

                        haploid

                        06020455_0001

                        x

                        93

                        98

                        haploid

                        05075185_0001

                        x

                        94

                        99

                        haploid

                        05090522_0004

                        x

                        95

                        100

                        haploid

                        06020625_0002

                        x

                        96

                        101

                        haploid

                        05100812_0002

                        x

                        97

                        102

                        haploid

                        05100862_0001

                        x

                        98

                        103

                        haploid

                        05030224_0002

                        x

                        99

                        104

                        haploid

                        05040439_0001

                        x

                        100

                        105

                        haploid

                        05040317_0003

                        x

                        101

                        106

                        haploid

                        05080030_0001

                        x

                        102

                        107

                        haploid

                        05070703_0003

                        x

                        103

                        108

                        haploid

                        05080485_0001

                        x

                        104

                        109

                        haploid

                        05110470_0002

                        x

                        105

                        110

                        haploid

                        05100423_0001

                        x

                        106

                        111

                        haploid

                        05110423_0001

                        x

                        107

                        112

                        haploid

                        05080362_0003

                        x

                        108

                        113

                        haploid

                        05110625_0001

                        x

                        109

                        114

                        haploid

                        05120719_0001

                        x

                        110

                        115

                        haploid

                        05121073_0002

                        x

                        111

                        116

                        haploid

                        06050726_0002

                        x

                        112

                        117

                        haploid

                        06060063_0001

                        x

                        113

                        119

                        haploid

                        06121220_0001

                        x

                        114

                        120

                        haploid

                        06080516_0001

                        x

                        115

                        121

                        haploid

                        06090505_0002

                        x

                        116

                        122

                        haploid

                        06090407_0004

                        x

                        117

                        123

                        haploid

                        06051133_0002

                        x

                        118

                        124

                        haploid

                        06060740_0031

                        x

                        119

                        125

                        haploid

                        06060740_0077

                        x

                        120

                        126

                        haploid

                        06060740_0090

                        x

                        121

                        127

                        haploid

                        06120178_0001

                        x

                        122

                        128

                        haploid

                        06090960_0003

                        x

                        123

                        129

                        haploid

                        06090657_0001

                        x

                        124

                        130

                        haploid

                        06120377_0001

                        x

                        125

                        131

                        haploid

                        06070208_0001

                        x

                        126

                        132

                        haploid

                        07010308_0001

                        x

                        127

                        133

                        haploid

                        06121125_0001

                        x

                        128

                        134

                        haploid

                        06121125_0002 A

                        x

                        129

                        135

                        haploid

                        06121125_0002 B

                        x

                        130

                        136

                        haploid

                        06019052_0005

                        x

                        131

                        137

                        haploid

                        06129197_0001

                        x

                        132

                        138

                        haploid

                        06079077_0001

                        x

                        133

                        139

                        haploid

                        07019130_0003

                        x

                        134

                        140

                        haploid

                        06075474_0001

                        x

                        135

                        141

                        haploid

                        06075474_0003

                        x

                        136

                        142

                        haploid

                        06075544_0001

                        x

                        137

                        143

                        haploid

                        06045801_0001

                        x

                        138

                        144

                        haploid

                        06065285_0001

                        x

                        139

                        145

                        haploid

                        06081027_0001

                        x

                        140

                        146

                        haploid

                        06090264_0001

                        x

                        141

                        147

                        haploid

                        06090264_0002

                        x

                        142

                        148

                        haploid

                        06070430_0001

                        x

                        143

                        149

                        haploid

                        06090861_0001

                        x

                        144

                        150

                        haploid

                        06051245_0001

                        x

                        145

                        151

                        haploid

                        06070716_0001

                        x

                        146

                        152

                        haploid

                        06051468_0001

                        x

                        147

                        153

                        haploid

                        06075617_0001

                        x

                        148

                        154

                        haploid

                        06040273_0001

                        x

                        149

                        155

                        haploid

                        06080584_0001

                        x

                        150

                        156

                        haploid

                        06070825_0001

                        x

                        151

                        158

                        haploid

                        06110390_0015

                        x

                        152

                        159

                        haploid

                        06031385_0001

                        x

                        153

                        160

                        haploid

                        06045657_0001

                        x

                        154

                        161

                        haploid

                        06110204_0008

                        x

                        155

                        162

                        haploid

                        06050161_0001

                        x

                        156

                        163

                        haploid

                        06071068_0010

                        x

                        157

                        164

                        haploid

                        06100785_0002

                        x

                        158

                        165

                        haploid

                        06010987_0028

                        x

                        159

                        166

                        haploid

                        07010166_0001

                        x

                        160

                        167

                        haploid

                        06100730_0001

                        x

                        161

                        168

                        haploid

                        06080681_0001

                        x

                        162

                        169

                        haploid

                        06080532_0005

                        x

                        163

                        170

                        haploid

                        06040024_0001

                        x

                        164

                        172

                        haploid

                        06080217_0010

                        x

                        165

                        173

                        haploid

                        06120975_0001

                        x

                        166

                        174

                        haploid

                        06070581_0002

                        x

                        167

                        175

                        haploid

                        06060477_0001

                        x

                        168

                        176

                        haploid

                        06120852_0001

                        x

                        169

                        177

                        haploid

                        06091392_0001

                        x

                        170

                        178

                        haploid

                        06060344_0001

                        x

                        171

                        179

                        haploid

                        06090211_0001

                        x

                        172

                        180

                        haploid

                        06100858_0001

                        x

                        173

                        181

                        haploid

                        06080272_0007

                        x

                        174

                        182

                        haploid

                        06050493_0004

                        x

                        175

                        183

                        haploid

                        06101033_0002

                        x

                        176

                        184

                        haploid

                        06081043_0001

                        x

                        177

                        185

                        haploid

                        07011057_0001

                        x

                        178

                        186

                        haploid

                        06070921_0001

                        x

                        179

                        187

                        haploid

                        06111210_0002

                        x

                        180

                        188

                        haploid

                        06121495_0001

                        x

                        181

                        189

                        haploid

                        06110610_0001

                        x

                        182

                        190

                        haploid

                        06090772_0001

                        x

                        183

                        191

                        haploid

                        06090318_0002

                        x

                        184

                        192

                        haploid

                        06121313_0001

                        x

                        185

                        193

                        haploid

                        06085027_0001

                        x

                        186

                        194

                        haploid

                        06090109_0001

                        x

                        187

                        195

                        haploid

                        06080157_0001

                        x

                        188

                        196

                        haploid

                        06121316_0001

                        x

                        189

                        197

                        haploid

                        06110900_0001

                        x

                        190

                        198

                        haploid

                        06070228_0002

                        x

                        191

                        199

                        haploid

                        06101174_0001

                        x

                        192

                        200

                        haploid

                        06060805_0001

                        x

                        193

                        201

                        haploid

                        06085063_0001

                        x

                        194

                        202

                        haploid

                        06101037_0001

                        x

                        195

                        203

                        haploid

                        06110444_0002

                        x

                        196

                        204

                        haploid

                        06101487_0001

                        x

                        197

                        205

                        haploid

                        06100937_0001

                        x

                        198

                        206

                        haploid

                        06090820_0002

                        x

                        199

                        207

                        haploid

                        06070039_0001

                        x

                        200

                        208

                        haploid

                        06070772_0001

                        x

                        201

                        209

                        haploid

                        07011408_0001

                        x

                        202

                        210

                        haploid

                        07011408_0002

                        x

                        203

                        211

                        haploid

                        06100319_0001

                        x

                        204

                        212

                        haploid

                        06070468_0001

                        x

                        205

                        213

                        haploid

                        06121385_0002

                        x

                        206

                        214

                        haploid

                        06100537_0001

                        x

                        207

                        215

                        haploid

                        06120726_0001

                        x

                        208

                        216

                        haploid

                        06070883_0001

                        x

                        209

                        217

                        haploid

                        06040041_0001

                        x

                        210

                        218

                        haploid

                        06100263_0001

                        x

                        211

                        219

                        haploid

                        06040043_0009

                        x

                        212

                        220

                        haploid

                        06101232_0001

                        x

                        213

                        221

                        haploid

                        06060189_0003

                        x

                        214

                        222

                        haploid

                        06091275_0002

                        x

                        215

                        223

                        haploid

                        06060097_0001

                        x

                        216

                        224

                        haploid

                        06100873_0001

                        x

                        217

                        225

                        haploid

                        06050038_0001

                        x

                        218

                        226

                        haploid

                        06100025_0001

                        x

                        219

                        227

                        haploid

                        06100940_0002

                        x

                        220

                        228

                        haploid

                        06040800_0001

                        x

                        221

                        229

                        haploid

                        06071007_0002

                        x

                        222

                        230

                        haploid

                        06020043_0026

                        x

                        223

                        231

                        haploid

                        06060811_0153

                        x

                        224

                        232

                        haploid

                        06080751_0001

                        x

                        225

                        233

                        haploid

                        06050178_0068

                        x

                        226

                        234

                        haploid

                        06040287_0001

                        x

                        227

                        236

                        haploid

                        06101496_0001

                        x

                        228

                        237

                        haploid

                        06040643_0001

                        x

                        229

                        238

                        haploid

                        06045788_0003

                        x

                        230

                        239

                        haploid

                        06050326_0001

                        x

                        231

                        240

                        haploid

                        06080649_0002

                        x

                        232

                        241

                        haploid

                        06080649_0003

                        x

                        233

                        242

                        haploid

                        06080601_0001

                        x

                        234

                        243

                        haploid

                        06101247_0001

                        x

                        235

                        244

                        haploid

                        06111271_0001

                        x

                        236

                        245

                        haploid

                        06090337_0001

                        x

                        237

                        246

                        haploid

                        06050125_0002

                        x

                        238

                        247

                        haploid

                        06050331_0001

                        x

                        239

                        248

                        haploid

                        06060728_0002

                        x

                        240

                        249

                        haploid

                        06080109_0001

                        x

                        241

                        250

                        haploid

                        06101048_0001

                        x

                        242

                        251

                        haploid

                        06051077_0001

                        x

                        243

                        253

                        haploid

                        06041067_0003

                        x

                        244

                        254

                        haploid

                        06040302_0002

                        x

                        245

                        255

                        haploid

                        06110121_0001

                        x

                        246

                        256

                        haploid

                        06090845_0001

                        x

                        247

                        257

                        haploid

                        06060375_0001

                        x

                        248

                        258

                        haploid

                        06070494_0001

                        x

                        249

                        259

                        haploid

                        06040938_0003

                        x

                        250

                        260

                        haploid

                        06081010_0001

                        x

                        251

                        261

                        haploid

                        06070415_0003

                        x

                        252

                        263

                        haploid

                        07010776_0001

                        x

                        253

                        264

                        haploid

                        06120890_0001

                        x

                        254

                        265

                        haploid

                        06120316_0001

                        x

                        255

                        266

                        haploid

                        06121413_0001

                        x

                        256

                        267

                        haploid

                        06090247_0001

                        x

                        257

                        268

                        haploid

                        06090247_0002

                        x

                        258

                        269

                        haploid

                        06090801_0001

                        x

                        259

                        270

                        haploid

                        06041160_0002

                        x

                        260

                        271

                        haploid

                        06031248_0001

                        x

                        261

                        272

                        haploid

                        07010075_0001

                        x

                        262

                        273

                        haploid

                        07011039_0001

                        x

                        263

                        274

                        haploid

                        06041232_0001

                        x

                        264

                        275

                        haploid

                        06101271_0002

                        x

                        265

                        276

                        haploid

                        06060506_0001

                        x

                        266

                        277

                        haploid

                        06080566_0001

                        x

                        267

                        278

                        haploid

                        06060124_0001

                        x

                        268

                        279

                        haploid

                        07020168_0001

                        x

                        269

                        281

                        haploid

                        06090909_0002

                        x

                        270

                        282

                        haploid

                        06080869_0001

                        x

                        271

                        1

                        commercial pisifera

                        BL605/39-04

                        2x

                        272

                        2

                        commercial pisifera

                        BL607/91-10

                        2x

                        273

                        3

                        commercial pisifera

                        BL612/84-05

                        2x

                        274

                        4

                        commercial pisifera

                        BL1120/75-07

                        2x

                        275

                        5

                        commercial pisifera

                        BL143/04-10

                        2x

                        276

                        6

                        commercial pisifera

                        BL147/21-05

                        2x

                        277

                        7

                        commercial pisifera

                        BL148/05-08

                        2x

                        278

                        8

                        commercial pisifera

                        BL158/A2-13

                        2x

                        279

                        1

                        commercial tenera

                        BL10452/207-02

                        2x

                        280

                        2

                        commercial tenera

                        BL10323/104-06

                        2x

                        281

                        3

                        commercial tenera

                        BL1177/184-09

                        2x

                        282

                        1

                        commercial dura

                        BL10887/08-22

                        2x

                        283

                        2

                        commercial dura

                        BL10885/08-27

                        2x

                        284

                        3

                        commercial dura

                        BL1221/51-14

                        2x

                        285

                        4

                        commercial dura

                        BL1222/32-02

                        2x

                        286

                        5

                        commercial dura

                        BL1224/14-19

                        2x

                        287

                        6

                        commercial dura

                        BL1231/02-01

                        2x

                        288

                        7

                        commercial dura

                        BL1235/14-01

                        2x

                        289

                        8

                        commercial dura

                        BL1125/03-02

                        2x

                        290

                        9

                        commercial dura

                        BL1124/17-09

                        2x

                        291

                        10

                        commercial dura

                        BL1136/01-02

                        2x

                        292

                        11

                        commercial dura

                        BL10868/12-10

                        2x

                        293

                        12

                        commercial dura

                        BL10868/12-11

                        2x

                        294

                        13

                        commercial dura

                        BL10868/12-13

                        2x

                        295

                        14

                        commercial dura

                        BL10879/08-06

                        2x

                        296

                        15

                        commercial dura

                        BL10879/08-07

                        2x

                        297

                        16

                        commercial dura

                        BL10879/08-09

                        2x

                        298

                        17

                        commercial dura

                        BL10883/04-06

                        2x

                        299

                        18

                        commercial dura

                        BL10883/04-08

                        2x

                        300

                        19

                        commercial dura

                        BL10883/04-09

                        2x

                        301

                        20

                        commercial dura

                        BL10883/05-06

                        2x

                        302

                        21

                        commercial dura

                        BL10891/04-23

                        2x

                        303

                        22

                        commercial dura

                        BL10891/04-24

                        2x

                        304

                        23

                        commercial dura

                        BL10891/05-22

                        2x

                        305

                        24

                        commercial dura

                        BL10891/05-23

                        2x

                        306

                        25

                        commercial dura

                        BL10873/52-18

                        2x

                        307

                        26

                        commercial dura

                        BL10873/52-19

                        2x

                        308

                        27

                        commercial dura

                        BL10873/52-21

                        2x

                        309

                        28

                        commercial dura

                        BL10873/53-19

                        2x

                        310

                        29

                        commercial dura

                        BL1229/48-15

                        2x

                        311

                        30

                        commercial dura

                        BL1230/42-15

                        2x

                        312

                        31

                        commercial dura

                        A1122/04-01

                        2x

                        313

                        32

                        commercial dura

                        A1122/12-05

                        2x

                        314

                        33

                        commercial dura

                        A1122/12-08

                        2x

                        315

                        34

                        commercial dura

                        A1122/36-02

                        2x

                        316

                        35

                        commercial dura

                        A1123/01-02

                        2x

                        317

                        36

                        commercial dura

                        A1123/01-06

                        2x

                        318

                        37

                        commercial dura

                        A1123/01-07

                        2x

                        319

                        38

                        commercial dura

                        A1123/01-12

                        2x

                        320

                        39

                        commercial dura

                        A1130/02-02

                        2x

                        321

                        40

                        commercial dura

                        A1130/02-06

                        2x

                        322

                        41

                        commercial dura

                        A1130/02-10

                        2x

                        323

                        42

                        commercial dura

                        A1130/02-16

                        2x

                        324

                        43

                        commercial dura

                        A1127/08-16

                        2x

                        325

                        44

                        commercial dura

                        A1127/08-06

                        2x

                        326

                        45

                        commercial dura

                        A1127/05-11

                        2x

                        327

                        46

                        commercial dura

                        A1127/05-03

                        2x

                        328

                        47

                        commercial dura

                        B1134/35-09

                        2x

                        329

                        48

                        commercial dura

                        B1133/07-10

                        2x

                        330

                        49

                        commercial dura

                        B1136/21-11

                        2x

                        331

                        50

                        commercial dura

                        B1136/21-12

                        2x

                        332

                        51

                        commercial dura

                        C1128/07-14

                        2x

                        333

                        52

                        commercial dura

                        C1121/13-08

                        2x

                        334

                        53

                        commercial dura

                        BL11508/111-1

                        2x

                        335

                        54

                        commercial dura

                        BL11396/11-21

                        2x

                        336

                        1

                        Ghana wild

                        K31-1/GHANA/1-1

                        2x

                        337

                        2

                        Ghana wild

                        K31-1/GHANA/41-498

                        2x

                        338

                        3

                        Ghana wild

                        K31-1/GHANA/39-875

                        2x

                        339

                        4

                        Ghana wild

                        K31-1/GHANA/31-430

                        2x

                        340

                        5

                        Ghana wild

                        K31-1/GHANA/26-629

                        2x

                        341

                        6

                        Ghana wild

                        K31-1/GHANA/24-1164

                        2x

                        342

                        7

                        Ghana wild

                        K31-1/GHANA/56-1185

                        2x

                        343

                        8

                        Ghana wild

                        K31-1/GHANA/29-1087

                        2x

                        344

                        9

                        Ghana wild

                        K31-1/GHANA/38-1193

                        2x

                        345

                        10

                        Ghana wild

                        K31-1/GHANA/43-994

                        2x

                        346

                        11

                        Ghana wild

                        K31-1/GHANA/8-1100

                        2x

                        347

                        12

                        Ghana wild

                        K31-1/GHANA/11-1192

                        2x

                        348

                        13

                        Ghana wild

                        K31-1/GHANA/35-1190

                        2x

                        349

                        14

                        Ghana wild

                        K31-1/GHANA/3-46

                        2x

                        350

                        15

                        Ghana wild

                        K31-1/GHANA/5-102

                        2x

                        351

                        16

                        Ghana wild

                        K31-1/GHANA/7-121

                        2x

                        352

                        17

                        Ghana wild

                        K31-1/GHANA/12-239

                        2x

                        353

                        18

                        Ghana wild

                        K31-1/GHANA/14-350

                        2x

                        354

                        19

                        Ghana wild

                        K31-1/GHANA/18-368

                        2x

                        355

                        20

                        Ghana wild

                        K31-1/GHANA/19-245

                        2x

                        356

                        21

                        Ghana wild

                        K31-1/GHANA/21-1180

                        2x

                        357

                        22

                        Ghana wild

                        K31-1/GHANA/32-1141

                        2x

                        358

                        23

                        Ghana wild

                        K31-1/GHANA/37-1124

                        2x

                        359

                        24

                        Ghana wild

                        K31-1/GHANA/45-448

                        2x

                        360

                        25

                        Ghana wild

                        K31-1/GHANA/47-1175

                        2x

                        361

                        26

                        Ghana wild

                        K31-1/GHANA/50-1037

                        2x

                        362

                        27

                        Ghana wild

                        K31-1/GHANA/52-547

                        2x

                        363

                        28

                        Ghana wild

                        K31-1/GHANA/53-1167

                        2x

                        364

                        29

                        Ghana wild

                        K31-1/GHANA/54-1196

                        2x

                        365

                        30

                        Ghana wild

                        K31-1/GHANA/57-1153

                        2x

                        Table 7

                        Primer pairs used in the Principal Coordinates Analysis to compare the genetic diversity and affinities of Hs compared with a representative sample of commercial and wild diploid palms (listed in Table 6).

                        No

                        Primer

                        Forward (5'-3')

                        Reverse (5'-3')

                        1

                        1996

                        CACTGGGGTCATCTTCATCT

                        TCGTTCTCTTTCCTTTTGTC

                        2

                        2215

                        GAACTTGGCGTGTAACT

                        TGGTAGGTCTATTTGAGAGT

                        3

                        2427

                        GAAGGGGCATTGGATTT

                        CAGGTGACCAAGTGTAAT

                        4

                        2569

                        TAGCCGCACTCCCACGAAGC

                        CCAGAATCATCAGACTCGGACAG

                        5

                        2595

                        TCAAAGAGCCGCACAACAAG

                        ACTTTGCTGCTTGGTGACTTA

                        6

                        2600

                        GGGGATGAGTTTGTTTGTTC

                        GGCAACATGAAGGTAAG

                        7

                        3282

                        GTAACAGCATCCACACTAAC

                        GCAGGACAGGAGTAATGAGT

                        8

                        3298

                        GACTACCGTATTGCGTTCAG

                        TTTATCAGGAGTTTTTGTTTGAGAG

                        9

                        3311

                        AATCCAAGTGGCCTACAG

                        TCCCTACAATAGCCATCTC

                        10

                        3321

                        CAAGGAGGAGCAGGTGAG

                        TACGGCCTCGGTTCTACAC

                        11

                        3399

                        AGCCAATGAAGGATAAAGG

                        CCACTTAGAGGTAAAACAACAG

                        12

                        3400

                        CAATTCCAGCGTFAFTATAG

                        AGTGGCAGTGGAAAAACAGT

                        13

                        3433

                        GGTTCAATGGCATACAT

                        ACTCCCCTCTTTGACAT

                        14

                        3538

                        TCAAGCCACATCCTAACTAC

                        CTCATAGCCTTTGTTGTGT

                        15

                        3544

                        AGCAGGGCAAGAGCAATACT

                        TTCAGCAGCAGGAAACATC

                        16

                        3546

                        GCCTATCCCCTGAACTATCT

                        TGCACATACCAGCAACAGAG

                        17

                        3574

                        AGAGACCCTATTTGCTTGAT

                        GACAAAGAGCTTGTCACAC

                        18

                        3711

                        GTCTCATGTGGCTACCTCTC

                        GCTAGGTGAAAAATAAAGTT

                        19

                        3819

                        CCTCCTTTGGAATTATG

                        GTGTTTGATGGGACATACA

                        20

                        219

                        TTTGCTCGGCGGATACAT

                        GGAGGGCAGGAACAAAAAGT

                        21

                        257

                        GCAGCTAGTCACCTGAAC

                        GACGAGACTGGAAAGATG

                        22

                        782

                        CGTTCATCCCACCACCTTTC

                        GCTGCGAGGCCACTGATAC

                        23

                        783

                        GAATGTGGCTGTAAATGCTGAGTG

                        AAGCCGCATGGACAACTCTAGTAA

                        24

                        882

                        TTGATCTTAGACATAACATACTGTA

                        AAAGCGCGTAATCTCATAGT

                        25

                        894

                        TGCTTCTTGTCCTTGATACA

                        CCACGTCTACGAAATGATAA

                        26

                        3213

                        GCTCTTTGTATTTCCTGGTTC

                        AGCAGCAAACCCTACTAACT

                        27

                        3691

                        GCATCATTGGACTATCATACC

                        TTGTGAACCAGGGAACTATC

                        28

                        vs1

                        GAGATTACAAAGTCCAAACC

                        TCAAAATTAAGAAAGTATGC

                        All primers except VS1 were taken from Billotte et al. [27].

                        Colchicine treatment

                        Roots of confirmed haploid seedlings were washed and immersed in 2.5, 5.0, 7.5, or 10 mM aqueous colchicine for 5 h. Seedlings were then rinsed with water and planted (2:1:1 v/v compost, sand and soil).

                        Cross-fertilization using pollen from H plants

                        A developing male inflorescence of a confirmed H at the PMC stage was treated with 2.5 mM colchicine via injection into the spathe. This treatment was repeated at weekly intervals. The resultant pollen (0.03 g) was applied to a targeted section of the female inflorescence of a diploid dura palm. The inflorescence was then bagged to prevent inadvertent wind pollination.

                        In addition, some untreated H plants contained up to 30% fully stained pollen using Fluorescein diacetate (FDA) that was presumed to be viable. Pollen from these plants and from palms with apparently inviable pollen (unstained) was applied to targeted sections of a female inflorescence of diploid dura palms in the same way as above.

                        Declarations

                        Acknowledgements

                        This work was funded by Sumatra Bioscience as part of their R&D programme in oil palm. The authors are grateful for the assistance of all staff of the Breeding Department and Seed Production Unit at Bah Lias Research Station, Indonesia.

                        Authors’ Affiliations

                        (1)
                        School of Biological Sciences, University of Reading
                        (2)
                        Institute of Biological, Environmental and Rural Sciences, Aberystwyth University
                        (3)
                        Sumatra Bioscience Pte Ltd
                        (4)
                        PT Sumatra Bioscience, Bah Lias Research Station
                        (5)
                        BioHybrids International Ltd
                        (6)
                        Instituto de Biología Vegetal y Biotecnología, Universidad de Talca

                        References

                        1. Duvick DN: Biotechnology in the 1930s: the development of hybrid maize. Nature Rev Genet 2001, 2:69–73.PubMedView Article
                        2. Horie T, Shiraiwa T, Homma K, Katsura K, Maeda S, Yoshida H: Can yields of lowland rice resume the increases that they showed in the 1980s? Plant Prod Sci 2005, 8:259–274.View Article
                        3. Forster BP, Thomas WTB: Doubled haploids in genetics and plant breeding. Plant Breeding Rev 2005, 25:57–88.
                        4. Cook RR: A haploid Marglobe tomato. J Hered 1936, 27:433–435.
                        5. Maluszynski M, Kasha KJ, Szarejko I: Published protocols for other crop plant species. In Doubled Haploid Production in Crop Plants: A Manual. Edited by: Maluszynski M, Kasha KJ, Forster BP, Szarejko I. Dordrecht: Kluwer; 2003:309–335.
                        6. Dunwell JM: Haploids in flowering plants: origins and exploitation. Plant Biotech J 2010, 8:377–424.View Article
                        7. Kelly-Yong TL, Lee KT, Mohamed AR, Bhatia S: Potential of hydrogen from oil palm biomass as a source of renewable energy worldwide. Energ Policy 2007, 35:5692–5701.View Article
                        8. Basiron Y: Palm oil production through sustainable plantations. Eur J Lipid Sci Technol 2007, 109:289–295.View Article
                        9. Food and Agriculture Organization of the United Nations. Agricultural Production Statistics [http://​faostat.​fao.​org/​]
                        10. Stone R: Ecology - Can palm oil plantations come clean? Science 2007, 317:1491.PubMedView Article
                        11. Wilcove DS, Koh LP: Addressing the threats to biodiversity from oil-palm agriculture. Biodivers Conserv 2010, 19:999–1007.View Article
                        12. Koh LP, Wilcove DS: Cashing in palm oil for conservation. Nature 2007, 448:993–994.PubMedView Article
                        13. Clements R, Posa MRC: Conservationists could slip up in oil-palm enterprise. Nature 2007, 449:403.PubMedView Article
                        14. Venter O, Meijaard E, Wilson K: Strategies and alliances needed to protect forest from palm-oil industry. Nature 2008, 451:16.PubMedView Article
                        15. Corley RHV: Potential productivity of tropical perennial crops. Exp Agric 1983, 19:217–237.View Article
                        16. Murphy DJ: Oil palm: future prospects for yield and quality improvements. Lipid Technology 2009, 21:257–260.View Article
                        17. Jones LH: Prospects for biotechnology in oil palm ( Elaeis guineensis ) and coconut ( Cocos nucifera ) improvement. Biotech Genet Engin Rev 1989, 7:281–296.
                        18. Whitehead RA, Chapman GP: Twinning and haploidy in Cocos nucifera . Nature 1962, 195:1228–1229.View Article
                        19. Bouvier L, Zhang YX, Lespinasse Y: Two methods of haploidization in pear, Pyrus communis L.: greenhouse seedling selection and in situ parthenogenesis induced by irradiated pollen. Theor Appl Genet 1993, 87:229–232.View Article
                        20. Germana MA: Haploids and doubled haploids in fruit trees. In Advances in Haploid Production in Higher Plants. Edited by: Touraev A, Forster BP, Jain SM. The Netherlands: Springer-Verlag; 2009:241–263.View Article
                        21. Lim W, Earle ED: Enhanced recovery of doubled haploid lines from parthenogenetic plants of melon. Plant Cell Tiss Org 2009, 98:351–356.View Article
                        22. Finkel E: With 'phenomics,' plant scientists hope to shift plant breeding into overdrive. Science 2009, 325:380–381.PubMedView Article
                        23. Reijnders L, Huijbregts MAJ: Palm oil and the emission of carbon-based greenhouse gases. J Clean Product 2008, 16:477–482.View Article
                        24. Parveez GKA: Biolistic mediated production of transgenic oil palm. Method Mol Biol 2009, 477:301–320.View Article
                        25. Persson UM, Azar C: Preserving the world's tropical forests - a price on carbon may not do. Environ Sci Technol 2010, 44:210–215.PubMedView Article
                        26. Croxford AE, Rogers T, Caligari PDS, Wilkinson MJ: High-resolution melt analysis to identify and map sequence-tagged site anchor points onto linkage maps: a white lupin ( Lupinus albus ) map as an exemplar. New Phytol 2008, 180:594–607.PubMedView Article
                        27. Billotte N, Marseillac N, Risterucci AM, Adon B, Brottier P, Baurens FC, Singh R, Herran A, Asmady H, Billot C, Amblard P, Durand-Gasselin T, Courtois B, Asmono D, Cheah SC, Rohde W, Ritter E, Charrier A: Microsatellite-based high density linkage map in oil palm ( Elaeis guineensis Jacq.). Theor Appl Genet 2005, 110:754–765.PubMedView Article
                        28. Billotte N, Risterucci AM, Barcelos E, Noyer JL, Amblard P, Baurens FC: Development, characterisation, and across-taxa utility of oil palm ( Elaeis guineensis Jacq.) microsatellite markers. Genome 2001, 44:413–425.PubMedView Article
                        29. Arumuganathan K, Earle ED: Estimation of nuclear DNA content of plants by flow cytometry. Plant Mol Biol Rep 1991, 9:221–231.
                        30. Peakall R, Smouse PE: GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 2006, 6:288–295.View Article
                        31. Orloci L: Multivariate analysis in vegetation research. 2nd edition. Boston: The Hague; 1978.

                        Copyright

                        © Dunwell et al. 2010

                        This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                        Advertisement