Open Access

Production of haploids and doubled haploids in oil palm

  • Jim M Dunwell1Email author,
  • Mike J Wilkinson2Email author,
  • Stephen Nelson3,
  • Sri Wening4,
  • Andrew C Sitorus4,
  • Devi Mienanti4,
  • Yuzer Alfiko4,
  • Adam E Croxford2,
  • Caroline S Ford2,
  • Brian P Forster5 and
  • Peter DS Caligari3, 5, 6
Contributed equally
BMC Plant Biology201010:218

DOI: 10.1186/1471-2229-10-218

Received: 2 June 2010

Accepted: 7 October 2010

Published: 7 October 2010

Abstract

Background

Oil palm is the world's most productive oil-food crop despite yielding well below its theoretical maximum. This maximum could be approached with the introduction of elite F1 varieties. The development of such elite lines has thus far been prevented by difficulties in generating homozygous parental types for F1 generation.

Results

Here we present the first high-throughput screen to identify spontaneously-formed haploid (H) and doubled haploid (DH) palms. We secured over 1,000 Hs and one DH from genetically diverse material and derived further DH/mixoploid palms from Hs using colchicine. We demonstrated viability of pollen from H plants and expect to generate 100% homogeneous F1 seed from intercrosses between DH/mixoploids once they develop female inflorescences.

Conclusions

This study has generated genetically diverse H/DH palms from which parental clones can be selected in sufficient numbers to enable the commercial-scale breeding of F1 varieties. The anticipated step increase in productivity may help to relieve pressure to extend palm cultivation, and limit further expansion into biodiverse rainforest.

Background

Success of early F1 hybrid maize varieties exemplifies the advantages of heterosis [1]. The use of doubled haploids as parents for F1 variety production fully exploits this phenomenon and has enabled substantial yield improvements in several crops [2, 3]. This strategy was outlined with the first DH crop variety [4] and has led to H/DH production systems being described for > 250 species [5]. However, few of these protocols generate the large numbers of Hs/DHs needed for commercial breeding, with just three methods (androgenesis, wide crossing, gynogenesis [6]) routinely adopted for H/DH production in only 30 species [5]. The most important of these methods in widespread use in commercial breeding is the generation of haploids in maize via pollination with a haploid inducing line such as a 'Stock 6' derivative. Desire for a more generic H/DH production system to improve agricultural yields is increasing as population growth, climate change, biofuel demand and other land-use pressures intensify. Clearly, in any species the production of F1 varieties depends not only on the production of homozygous lines to act as parents, but also it requires an efficient method to intercross the parents. This latter procedure is relatively simple in species with an outcrossing breeding system, like maize or oil palm, compared with those with an inbreeding system like rice or wheat. Production of F1 hybrids has been achieved successfully in this category of crops (for example hybrid rice in China) but often requires a male sterility system.

Annually, oil palm (Elaeis guineensis) yields eight to ten times more oil per hectare than rapeseed or soybean [7, 8] and in 2008 generated 38.9 million tonnes of oil worldwide [9]. The area assigned to the crop expanded ~1.7 fold between 1997 (8.7 M ha) and 2007 (14.6 M ha) [9] with further increases forecast. Over this same period global production of palm oil increased ~2.2 fold from 18 to 38.9 Mt y-1. Thus, yield increases have been achieved predominantly by expansion of cultivated area and not through yield enhancement. This trend raises concerns over the ecological impact of felling rainforest to accommodate oil palm cultivation [10, 11] and has stimulated debate over strategies to limit further agricultural expansion [1214]. One option explored here is to use market forces to help address the problem. If F1 varieties could increase yields sufficiently to exceed demand, commodity prices would fall. This would discourage clear felling and simultaneously incentivise early replacement of existing plantations with high-yielding varieties. Feasibility of the approach clearly relies on the ability to gain marked improvements in yield. Current yields of oil palm (generally 4-10.5 t ha-1) [15, 16] are much lower than the most conservative estimates of the crop's potential (17 t ha-1 [14] to 60 t ha-1 [16]). Indeed, yields per hectare in the two largest producer countries (Indonesia and Malaysia) have remained static for 30 years [9]. It should be noted, however, that in both these countries there are examples of selected varieties with much higher yields, with the highest yields from commercial breeding trials already exceeding 10 t ha-1.

To date, a H/DH-derived F1 breeding approach has been precluded by the repeated failure to secure H/DHs via anther or microspore culture [17] and successful generation of H/DHs in oil palm is unreported in the literature. The report of a spontaneous H in the related coconut palm [18] and in other species [19] nevertheless gave hope that spontaneous Hs may also occur in oil palm. However, the characteristically rare occurrence of spontaneous H/DHs necessitates development of an effective high-throughput screening system. Phenotypic characteristics of H/DH (slow growth, altered flowering phenology, smaller stomata and smaller organs [5]) could be used for diagnosis but are difficult to score qualitatively on a large scale and require plants of a reasonable size. An alternative strategy is to seek undefined atypical phenotypic features that may arise from reduced cell size and/or the hemizygous state of haploid individuals (homozygous for DHs) and that are manifest at the seedling stage when high-throughput visual assessment is more plausible. A more directed approach is also possible. Spontaneous H/DH seedlings are often associated with aberrant germination features, such as twin embryos from the same carpel [20], providing a defined feature for phenotypic selection. Here, we combined a large-scale visual survey for undefined atypical palm seedling phenotypes coupled with active selection for seeds with twin embryos to assemble a sub-population of seedlings enriched for H/DHs.

Results

Over two years, we performed two large-scale screens for morphological 'off-types' among oil palm seedlings generated by the Bah Lias Research Station, Indonesia. The first screen utilised 10,900,000 seedlings from a wide range of crosses and identified 3,854 morphological 'off-types' (H/DH candidates), of which 53 had twin embryos and 3,801 were phenotypically abnormal (Figure 1). The second screen of approximately 10,000,000 seedlings from commercial seed production activities and approximately 1,000,000 seedlings from breeding experiments generated 5,704 H/DH candidates, of which 5,601 were phenotypically abnormal and 103 had twin embryos. More than 2,000 of these seedlings (including all those with twin embryos) were transferred to the nursery prior to further screening. Although Hs could be identified relatively easily on the basis of their reduced genome size, we initially wished to target the more difficult, but more valuable DHs to circumvent the need for chromosome doubling. For the second level screen, we exploited the fact that Hs and DHs would be either hemi- or homozygous across all loci; thus individuals exhibiting heterozygosity at any locus could be discarded. Applying this logic, we performed a sequential screen using 9-15 microsatellite markers (Table 1) on all individuals and found 117 seedlings that exhibited a single allele across all loci (Table 2). These individuals were retained as candidate H/DH, and subsequent flow cytometry of leaf samples identified 83 as H, and 34 as diploid (Table 2). The haploid status of six palms was further confirmed by cytological examination of intact cells from root squashes. Each contained the expected 16 chromosomes (Figure 2).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig1_HTML.jpg
Figure 1

Seed germination morphology for H/DH identification. a: normal; b: abnormal; c: twin embryo.

Table 1

Microsatellite primer pairs used to identify homozygous DH or hemizygous H candidates in the initial molecular screen.

No.

Forward primer (5'-3')

Reverse primer (5'-3')

1

GAGATTACAAAGTCCAAACC

TCAAAATTAAGAAAGTATGC

2

ACGCATGCAGCTAGCTTTTC

CGCGTGAAAGATATGAATCAAC

3

CACGCACGCAGTTTATTCTT

GGATGTATGCTTTACCTCCGAAT

4

CCCCTTTTGCTTCCCTATTT

CTCCTTTTCCCCATCACAGA

5

GACACAAGCAAAAACAAAAGCA

ATTCTGAAAGGAGGGGGAAA

6

ATATGTGTGGGTGTGCGTGT

TGCCTCTGGTTGTTAGTCTGG

7

TCTCTCTCTCTCTCTCTATGTGTGTGT

TGGCAATCAGCACACATTCT

8

GCAGCTCTTTCCACACCTCT

TGTGGTCTCCTGAGGAAGATG

9

TTTTCCCCATCACAGAATTG

CCCCTTTTGCTTCCCTATTT

10

TAGCCGCACTCCCACGAAGC

CCAGAATCATCAGACTCGGACAG

11

AGCTCTCATGCAAGTAAC

TTCAACATACCGTCTGTA

12

CCTTCAAGCAAAGATACC

GGCACCAAACACAGTAA

13

GTAGCTTGAACCTGAAA

AGAACCACCGGAGTTAC

14

GCTCGTTTTTGTTTAGGTGA

TTTTCTCCATAGTCCGTTAC

15

CCTCGGGTTATCCTTTTTACC

TGGCTGGCTTCGGTCTTAG

Markers 10-15 obtained from Billotte et al. [27].

Table 2

Results of ploidy analysis by flow cytometry of 117 candidate H/DH palms identified as both morphologically atypical and homozygous for the markers listed in Table 1.

Candidate

DNA sample code

No. markers used

Ploidy

50-Mix5-7

11260406301

9

x

50-03060367C

07280501801

15

x

50-03060260C-2

07280501901

15

x

53-03080954C-2

09270500101

10

x

53-03090761C-5

09280504501

10

x

BATCH 51;03060318C;1

060728_0010_01_a

15

x

BATCH 53;03090761C;5

060728_0018_01_a

15

x

0623/172;05095508C;1

060728_0021_01_a

15

x

BATCH 50;03060260C;2

060728_0027_01_a

15

x

0611/32;05050248C;1

060728_0032_01_a

15

x

0611/16;05050228C;1

060728_0034_01_a

15

x

BATCH 53;03080954C;2

060728_0035_01_a

15

x

06 412;04059061B;3

060728_0050_01_a

14

2x

0628/152;05100720C;1

060729_0021_01_a

15

x

0628/185;05100351C;1

060729_0063_01_a

15

x

BATCH 51;03060626C;1

060729_0127_02_a

15

x

BATCH 67;0409034MC;2

060729_0130_02_a

14

2x

BATCH 67;0409034MC;4

060729_0131_02_a

15

2x

BATCH 67;0409034MC;15

060729_0132_02_a

15

2x

BATCH 65;0409034MC;7

060729_0134_02_a

15

2x

BATCH 65;0409034MC;35

060729_0138_02_a

15

2x

BATCH 65;0409034MC;56

060729_0139_02_a

15

2x

BATCH 65;0409034MC;50

060729_0141_02_a

15

2x

BATCH 65;0409034MC;47

060729_0142_02_a

15

2x

0628/53;05090595C;1

060731_0043_01_a

15

x

0627/125;05090717C;2

060731_0065_01_a

15

x

0627/12;05080220C;1

060731_0080_01_a

15

x

0627/6;05080095C;1

060731_0086_01_a

14

x

0631/Normal;05039033B;31

060731_0265_01_a

14

x

64-0409021MC-34

02130604301

15

2x

64-0410040MC-1

02130604801

15

2x

51-03060626C

02130605301

15

x

64-0410040MC-20

02140600401

15

2x

64-0410040MC-16

02140600801

15

2x

65-0409021MC-2

02140601001

15

2x

06 412B-04059061B-3

02170605501

15

2x

06 412B-04129091B

02170605801

15

2x

0550-15/05010827C

02200602401

15

x

0550-17/05010442C-1

02200602601

15

x

0550-23/05020059C

02200603101

15

x

0550-33/05020568C

02200603401

15

x

0550-36/05020420C-2

02200603701

15

x

0550-40/05010880C

02200607501

14

x

0551-36/05020511C

02200607601

15

x

0551-32/05020361C-1

02210600401

15

x

0552-4/05010836C-2

02210600901

15

x

0552-38/05020501C

02210603101

14

x

0552-39/05020415C

02210603201

15

x

0552-31/05020858C

02210603701

15

x

0552-91/05020375C

02210603901

15

x

0552-111/05020626C

02210607201

15

x

0552-128/05020558C-1

02210607701

15

x

0601-35/05020946C

02210608201

15

x

0601-42/05030201C-6

02210609501

15

x

0601-51/05030224C-2

02220600201

15

x

0607-21/05040317C-3

02220601801

14

x

0606-32/05040240C

02220606201

13

x

0601-77/05020961C

02230600701

15

x

0601-62/05030147C

02230601401

15

x

0601-54/05030462C

02230601901

15

x

0551-21/05020271C-1

02200605801

14

x

0601-9/05020843C-2

02230603101

15

x

0602-17/05020631C-1

02230605501

15

x

0607-111/05040970C-1

03010600201

15

x

0607-81/05040578C-1

03010600501

15

x

0607-73/05040573C-1

03010605101

15

x

0607-89/05040748C-3

03010605501

15

x

0607-102/05050016C-2

03010606601

15

x

0608-15/05040519C-3

03010606901

15

x

0608-45/05041003C-1

03150603401

15

x

0610-60/05041024C-2

03150604401

15

x

0610-124/05055039C-1

03150604601

15

x

0609-54/05050089C-2

03150604701

15

x

0610-41/05050352C-1

03150606701

15

x

0609-58/05050255C-1

03220600201

15

x

0610-82/05050099C-2

03220601401

15

x

0610-77/05050353C-1

03220602701

15

x

0610-121/05055090C-1

03220603301

15

x

0610-81/05050099C-1

03220605901

15

x

0609-100/05055311C-1

03290600301

15

x

0610-11/05040938C-1

03290601101

15

x

0610-68/05050376C-3

03290602001

15

x

0610-58/05050344C-1

03290602201

15

x

0610-73/05050594C-3

03290603301

15

x

0611-84/05050714C-4

03290605001

15

x

0611-70/05050223C-1

03290606701

15

x

0611-73/05050351C-1

03290608001

15

x

0610-67/05050376C-2

04050600501

15

x

0610-40/05050102C-2

04050600901

15

x

0611-99/05050544C-1

04050602601

15

x

0611-110/05055011C-1

04050603601

15

x

0612-2/05050017C-1

04050609101

15

x

0612-70/05050530C-1

04050609201

15

x

0612-76/05050512C-1

04050610301

15

x

0611-109/05055144C-1

04120600101

15

x

0611-31/05050220C-1

04120600601

15

x

0611-38/05050284C-4

04120600901

15

x

0611-40/05050171C-1

04120601101

14

x

0612-80/05050713C-1

04120603101

15

x

65-0409034 MC-66

060829_0001_02_a

15

2x

65-0409034 MC-68

060829_0002_02_a

15

2x

65-0409034 MC-72

060829_0003_02_a

14

2x

65-0409034 MC-111

060829_0005_02_a

15

2x

65-0409034 MC-94

060829_0011_02_a

14

2x

65-0409034 MC-120

060829_0012_02_a

15

2x

65-0409034 MC-144

060829_0013_02_a

15

2x

65-0409034 MC-133

060829_0015_02_a

15

2x

65-0409034 MC-187

060829_0020_02_a

15

2x

65-0409034 MC-193

060829_0021_02_a

14

2x

65-0409034 MC-199

060829_0023_02_a

15

2x

65-0409034 MC-135

060829_0025_02_a

15

2x

65-0409034 MC-114

060829_0026_02_a

13

2x

65-0409034 MC-147

060829_0027_02_a

15

2x

65-0409034 MC-36 B

060829_0030_02_a

15

2x

65-0409034 MC-39 A

060829_0031_02_a

15

2x

65-0409034 MC-73 A

060829_0034_02_a

15

2x

65-0409034 MC-71 A

060829_0035_02_a

14

2x

Note: in this initial round, no DH was found. The DH (0644-219/05049582C) was detected in a subsequent batch.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig2_HTML.jpg
Figure 2

Chromosome spread of a haploid root cell from oil palm containing 16 C-metaphase chromosomes.

A larger-scale survey for heterozygosity was then performed using 97 additional microsatellites (Table 3) to confirm absolute hemizygosity of Hs and identify 'false' candidate DHs showing any heterozygosity. All Hs produced single-allele peak profiles across all microsatellites, thereby discounting fixed heterozygosity via locus duplication for all markers used. All diploids were heterozygous at several loci and so discarded. However, one diploid (0644-219/05049582C) identified from a later screen (see below) was homozygous across all 36 mapped loci found to be heterozygous in the maternal parent (palm number BL013/12-06). Taking account of linkage between mapped markers, the probability of such an individual occurring by chance following selfing was 8.72 × 10-8 (see Methods). This palm was therefore deemed a spontaneous DH.
Table 3

Microsatellite markers (described by Billotte et al. [27]) used for a larger-scale survey for hemizygosity of Hs and homozygosity of DH candidates previously identified by the morphological screen, microsatellite pre-screen (15 markers) and flow cytometry screen.

No.

Forward primer (5'-3')

Reverse primer (5'-3')

16

GACCTTTGTCAGCATACTTGGTGTG

GCAGGCCTGAAATCCCAAAT

17

ATGCATGTGATTTTATTAGGTGAGA

CGACCCTCAGTCAATCAGTAAG

18

AAGCTAGCGACCTATGATTTTAGA

AAACAAGTAATGTGCATAACCTTTC

19

CCCACCACCCCTAGCTTCTC

ACCCCGGTCCAAATAAAATC

20

AGAGAGAGAGAGTGCGTATG

GTCCCTGTGGCTGCTGTTTC

21

GGGTAGCAAACCTTGTATTA

ACTTCCATTGTCTCATTATTCT

22

CGAGGCCCAAAAACATTCAC

GGTCCCGATCCCGTCTACTG

23

TTGCGGCCCATCGTAATC

TCCCTGCAGTGTCCCTCTTT

24

AGGGAATTGGAAGAAAAGAAAG

TCCTGAGCTGGGGTGGTC

25

AGCAAGAGCAAGAGCAGAACT

CTTGGGGGCTTCGCTATC

26

TAGCCATGCCGCCACCACTT

CAATCCATTAGCGTGCCCTTCT

27

CTTACCCCGCCTCCTCTCCT

CGAAATGCCCTTCCTTTACACTA

28

CCTTATATCGCACGGGTTCC

TTCTTGGGGTCTCGCTACGG

29

GCAAGATGCAATGGAGTTCA

CAAACCGCAGCAAGTCAGA

30

GCAAAATTCAAAGAAAACTTA

CTGACAGTGCAGAAAATGTTATAGT

31

CGTTCATCCCACCACCTTTC

GCTGCGAGGCCACTGATAC

32

GAATGTGGCTGTAAATGCTGAGTG

AAGCCGCATGGACAACTCTAGTAA

33

ACATTCCCTCTATTATTCTCAC

GTTTTGTTTGGTATGCTTGT

34

AAGCCAACTTCACAGATATGTTGAT

ATGAGCCTAACAAAGCACATTCTAA

35

AGTGAGGTATGGTTGATTAGGA

TATTGATAGCATTTGGGATTAG

36

CTCCGATGGTCAAGTCAGA

AAATGGGGAAGGCAATAGTG

37

GCCGTTCAAGTCAATTAGAC

TTTGGGAGCAAGCATTATCA

38

TGCTTCTTGTCCTTGATACA

CCACGTCTACGAAATGATAA

39

CACCACATGAAGCAAGCAGT

CCTACCACAACCCCAGTCTC

40

TTTTATTTTCCCTCTCTTTTGA

ATTGCGTCTCTTTCCATTGA

41

CATATGGCGCACAGGCAC

GCAATACAAGAGCACCCAAAT

42

AGTTGGTTTGCTGATTTG

TGTTGCTTCTTTGATTTTC

43

GCTGAAGATGAAATTGATGTA

TTCAGGTCCACTTTCATTTA

44

ATGACCTAAAAATAAAATCTCAT

ACAGATCATGCTTGCTCACA

45

GGTGCAAGAGAGGAGGAATG

TTTGGTAGTCGGGCGTTTTA

46

GTTTGGCTTTGGACATG

TCCATCACAGGAGGTATAG

47

TGTTTTGTTTCGTGCATGTG

GGCTGACATGCAACACTAAC

48

CGGTTTTGTCGCATCTATG

GTCGTCAGGGAACAACAGT

49

CAATCATTGGCGAGAGA

CGTCACCTTTCAGGATATG

50

GAGCATGACGCAAACAAAGG

GCAACATGTTTGATGCATTAATAGTC

51

TCCAAGTAGCAAATGATGAC

TGCCCTGAAACCCTTGA

52

GAAGGGGCATTGGATTT

TACCTATTACAGCGAGAGTG

53

AACACTCCAGAAGCCAGGTC

GGTTTAGGTATTGGAACTGATAGAC

54

GATCCCAATGGTAAAGACT

AAGCCTCAAAAGAAGACC

55

TGTGGTTTGAGGCATCTTCT

GCCCACCAAAAGAAAGTAGT

56

TAGCCGCACTCCCACGAAGC

CCAGAATCATCAGACTCGGACAG

57

TCAAAGAGCCGCACAACAAG

ACTTTGCTGCTTGGTGACTTA

58

GGGGATGAGTTTGTTTGTTC

CCTGCTTGGCGAGATGA

59

TCTAATGCTCCCAAGGTACA

GGCTTGGTCCACGATCTT

60

AGCTCTCATGCAAGTAAC

TTCAACATACCGTCTGTA

61

TCCTCACTGCTCCTCTAATC

ACTCCCTATGGACCTTAGTC

62

AGGGAGGCGAACGAGAAACA

CGACTGCTGATGGGGAAGAG

63

CTACGGACTCACACCTATAT

ATGGTTCATCAATGAGATC

64

GTGAGCGATTGAGGGGTGTG

GGGGCTTGATTGAGTATTTCCA

65

AGGGCAAGTCATGTTTC

TATAAGGGCGAGGTATT

66

GAAGCCTGAGACCGCATAGA

TTCGGTGATGAAGATTGAAG

67

TTTCTTATGGCAATCACACG

GGAGGGCAGGAACAAAAAGT

68

GTTTATCATTTTGGGGTCAG

CGGTGTCCCTCAGGATGTA

69

CATGCACGTAAAGAAAGTGT

CCAAATGCACCCTAAGA

70

AATCCAAGTGGCCTACAG

CATGGCTTTGCTCAGTCA

71

TGTAGGTGGTGGTTAGG

TGTCAGACCCACCATTA

72

AGCAAGACACCATGTAGTC

GACACGTGGGATCTAGAC

73

AAAAGCCGATAGTGGGAACA

ATGCTGAGAGGTGGAAAATAGAG

74

GTCCATGTGCATAAGAGAG

CTCTTGGCATTTCAGATAC

75

AGCCAATGAAGGATAAAGG

CAAGCTAAAACCCCTAATC

76

CAATTCCAGCGTCACTATAG

AGTGGCAGTGGAAAAACAGT

77

GGGCTTTCATTTTCCACTAT

GCTCAACCTCATCCACAC

78

GACAGCTCGTGATGTAGA

GTTCTTGGCCGCTATAT

79

ACTTGTAAACCCTCTTCTCA

GTTTCATTACTTGGCTTCTG

80

CCTTCAAGCAAAGATACC

GGCACCAAACACAGTAA

81

CCACTGCTTCAAATTTACTAG

GCGTCCAAAACATAAATCAC

82

GGGAGAGGAAAAAATAGAG

CCTCCCTGAGACTGAGAAG

83

AGCAGGGCAAGAGCAATACT

TTCAGCAGCAGGAAACATC

84

GCCTATCCCCTGAACTATCT

TGCACATACCAGCAACAGAG

85

CATCAGAGCCTTCAAACTAC

AGCCTGAATTGCCTCTC

86

ATTCATTGCCATTCCCTTCA

TTGTCCCCTCTGTTCACTCA

87

ATTGCAGAGATGATGAGAAG

GAGATGCTGACAATGGTAGA

88

TCTCCCAAATCACTAGAC

ATCTGCAAGGCATATTC

89

ACGTTTTGGCAACTCTC

ACTCCCCTCTTTGACAT

90

TCCACTCTGGCAACTCC

AAGGATGGGCTTTGTAGT

91

TTTAGAGGACAAGGAGATAAG

CGACCGTGTCAAGAGTG

92

AGCAAAATGGCAAAGGAGAG

GGTGTGTGCTATGGAAGATCATAGT

93

GTAGCTTGAACCTGAAA

AGAACCACCGGAGTTAC

94

AAGCCACCAGGATCATC

GTCATTGCCACCTCTAACT

95

TTACTTGCTAAGCTCTCTAGC

TGGCTGTTTAATCTGTCTG

96

TCTATATTTGGTTGGCTTGA

ACTCATTTCAATCTCAGTGTC

97

TGCTACGTGCTGAAATA

ATTTCAGGTTCGCTTCA

98

CCTCCACTTCTCTTCATCTT

CTTCCTCAAGCTCAAACAAT

99

GATGTTGCCGCTGTTTG

CATCCCATTTCCCTCTT

100

ATGCTCCACCAAGTTTA

CACATCCTAGCATCATTG

101

AAGCAATATAGGTTCAGTTC

TCATTTTCTAATTCCAAACAAG

102

GCTCGTTTTTGTTTAGGTGA

TTTTCTCCATAGTCCGTTAC

103

CAGCACACAAATGACAT

CACCTTTCCTTTTTGTC

104

CCTATTCCTTACCTTTCTGT

GACTTACTATCTTGGCTCAC

105

CCTTGCATTCCACTATT

AGTTCTCAAGCCTCACA

106

CCTCCTTTGGAATTATG

GTGTTTGATGGGACATACA

107

ATTGGAGAGCACTTGGATAG

TTCTCTTCCTTCTCACTTGT

108

AGCCAGATGGAAATACAC

GTGCGATAAAGAGGAGAGT

109

TAGTTTTCCCATCACAGAGT

ACAATATTTAGACCTTCCATGAG

110

GTGCAGATGCAGATTATATG

CCTTTAGAATTGCCGTATC

111

ACAATAACCTGAGACAACAAGAAAC

ATACATCCCCTCCCCTCTCT

112

GAACTTGGCGTGTAACT

TGGTAGGTCTATTTGAGAGT

These initial screens collectively revealed 83 spontaneous Hs but no DHs (although one DH was discovered subsequently), with the undirected phenotypic 'off-type' selection proving substantially more effective than screening for twin embryos. This result suggests that our method could be used to secure large numbers of Hs but is less able to isolate DHs at useful frequencies. This finding, when coupled with the routine nature of H chromosome doubling in other crops [21], suggested the most promising route for commercial DH production lay in the isolation of Hs followed by somatic doubling. In subsequent screening of abnormal seedlings, high-throughput flow cytometry therefore replaced molecular analysis for candidate H identification. Haploid identity was then supported using at least 15 microsatellite markers. Plants identified as diploid by flow cytometry continued to be screened for DHs as above. Using this amended screening procedure, we have identified over 1,100 H palms from approximately 60 million seedlings (to July 2009).

To have maximum utility this H/DH material should encompass as much genetic diversity from within the breeding germplasm as possible. A Principal Coordinates Analysis performed on H profiles using 28 microsatellite loci showed the first two axes accounted for 58% of the detected variation. While most Hs had a strong affinity to commercial duras, Hs have also been generated from pisifera types and overall variability amongst Hs encompassed that seen for the entire commercial palm material (Figure 3).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig3_HTML.jpg
Figure 3

Principal Coordinates Analysis Plot of 95 diploid and 27 haploid palms based on 28 microsatellites. Red diamonds: haploids; green squares: commercial pisiferas; blue triangles: commercial teneras; yellow diamonds: commercial duras; purple diamonds: Ghanaian wild material. Microsatellite data in Table 7.

Effort then focussed on the creation of DHs from this rich germplasm of H genotypes (Figure 4). The most direct route to obtain DHs is to use chemical application to induce chromosome doubling. We applied a range of treatments to 50 H seedlings and screened leaves of the recovered material for evidence of chromosome doubling. Flow cytometry revealed that 48 seedlings contained substantial diploid sectors in their leaves; one palm was 100% doubled after exposure to10 mM colchicine (Figure 5) and 100 ppm GA3. To date, 16 H genotypes have produced pollen. This finding demonstrates scope for securing fertile gametes from diploid inflorescences or inflorescence sectors for DH or F1 production. Indeed, seed set using pollen from DH material has now been achieved (data not shown). Whilst further optimization work is required, our results when combined with experience in other crops [21] suggest routine production of fertile DH oil palm lines will be a relatively simple task.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig4_HTML.jpg
Figure 4

Selection of haploid oil palm plants growing in a nursery.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig5_HTML.jpg
Figure 5

Doubled haploid palm.

Discussion and Conclusions

The simple high-throughput phenotypic-genotypic seedling selection system used here provides a fourth practical approach to supplement androgenesis, wide crossing and gynogenesis [6] and has potential for many crops where H/DH production remains elusive. The prospect of adopting a similar untargeted approach more widely seems both plausible and attractive, and may be possible without experienced operators, especially as sophisticated phenomic screening systems [22] become more accessible.

In the case of oil palm, the efficacy of our H screening combined with the demonstrated ability to create DH palms, opens the way for the development of 100% true-breeding parental clones for F1 variety breeding. Thereafter, it is hoped that the potential genetic gain available from oil palm F1 hybrids will match that in other crops. If such a gain is achieved it could be beneficial in several ways. First, high-yielding F1 palms are likely to accelerate replacement of palms in existing plantations and cause a step-increase in production. Secondly, this breeding strategy provides greater flexibility for breeders to respond rapidly to emergent threats (e.g. climate change). Thirdly, using palm oil and its associated wastes for energy generation [7] could substantially reduce carbon-based emissions currently associated with the palm oil lifecycle [23]. Fourthly, DH oil palms could be exploited in combination with transgenic techniques that are now available for this crop [24]. Looking forward, the clear challenge is to maintain and improve oil palm productivity in the face of a changing climate sufficient to keep pace with growing demand [25]. However, it is important to point out that breeding is simply one stage in a long process from plantation to the eventual processed product and the economic realities of this international industry will finally determine the impact of any novel technology on the global agricultural system for this crop.

The provision here of a system for haploid-based F1 hybrid breeding in oil palm represents the first technological breakthrough likely to lead to step improvements in yield for this crop, and can also be applied to other crops recalcitrant to in vitro based H/DH systems. This methodology, in particular the application of high-throughput flow cytometry, has recently been applied successfully to two other tropical crops, namely rubber (Hevea brasiliensis L.) and cocoa (Theobroma cacao L.) (Nasution et al. unpublished).

Methods

Hs and DHs were identified using three methods: a morphological screen; homozygosity/hemizygosity assessment; and ploidy level measurement. Initial screens emphasized identification of candidate DHs where seedling morphology screening was followed by homozygosity/hemizygosity assessment using microsatellites. H/DHs were then distinguished by flow cytometry and DHs subjected to an extensive homozygosity screen (Figure 6). As spontaneous DH frequency was low, later screens emphasized H recovery where the morphological screen was followed by flow cytometry; homozygosity of candidate Hs was thereafter confirmed with microsatellites.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig6_HTML.jpg
Figure 6

Summary of stages for identification of haploid and doubled haploid palm.

Seed morphological screen

For seed storage, mesocarps were removed from freshly harvested seed, and seeds air-dried at ambient temperature (24 h). Seeds were thereafter stored at 25°C with 15-18% moisture content. To induce germination, stored seeds were re-hydrated over 3 d to 18-20% moisture content, followed by 38-40°C incubation (40-60 d). Seeds were then re-hydrated for a further 5 d to >22% moisture content, and air-dried at ambient temperature (4 h). Seeds were germinated at ambient temperature (7 d to 3 months after treatment) and examined for atypical germination morphology (Figure 1).

Molecular pre-screen to exclude heterozygotes

DNA was isolated from leaf tissue using DNeasy 96 Plant Kit (Qiagen, UK). Initial heterozygosity screens used 15 microsatellites (Table 1) yielding alleles readily distinguished by agarose gel electrophoresis (Figure 7). 10 μl PCR mixes comprised 1.0 μl 10× NH4 buffer (Bioline), 0.3 μl MgCl2 (10 mM), 0.4 μl dNTPs (10 mM), 0.2 μl each primer (10 mM), 1-5 ng DNA and 1U Taq polymerase (Bioline). Thermocycling conditions: 2 min at 94°C followed by 35 cycles of 94°C for 30 s, 52-58°C for 30 s and 72°C for 45 s, with a final extension of 72°C for 7 min. Candidates presenting two allelic bands after fractionation by (2-3% w/v metaphor) agarose gel electrophoresis were discarded.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2229-10-218/MediaObjects/12870_2010_Article_712_Fig7_HTML.jpg
Figure 7

PCR amplicons generated by microsatellite marker 10 fractionated in 2% w/v agarose. Lanes 1-11 & 12-20: candidate H/DH palm plants; lane L: HyperladderI (Bioline, UK); lane 21: heterozygote control; lane 22: homozygote control. Candidates in lanes 1, 3, 4, 7, 8, 10, 11, 13, 16, 17, 19, 20 were deemed heterozygous and discarded.

Extended molecular screen

Candidate DHs and some Hs were subjected to an extensive assay for heterozygosity using 97 fluorescently-labelled microsatellites (Table 3) with 150 seedlings of normal phenotype and 24 heterozygous tenera palms as controls. PCR conditions were as described above and resultant products were fractionated on an ABI3730XL capillary sequencer (Applied Biosystems, USA) by Macrogen Inc (Korea). Allele size was determined (Genemapper v4.0) against a GS400HD standard. Individuals with two alleles at any locus were discarded.

DH candidate verification

To verify DH candidate 0644-219/05049582C we screened 212 microsatellites (Table 4) for heterozygosity in the maternal parent (BL013/12-06). 10 μl PCR mixes comprising: 5 μl BioMix™(Bioline, UK), 0.05 μl forward primer plus M13 adaptor (10 μM), 0.2 μl labelled M13(-29) (10 μM) (Sigma Genosys, UK), 0.2 μl reverse primer (10 μM) and 5-10 ng DNA were subjected to: 2 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 52°C, 45 s at 72°C, with a final extension of 72°C for 7 min. Amplicons were surveyed for heterozygosity by high-resolution melt (HRM) analysis according to Croxford et al. [26] using the candidate as the reference comparator. Samples with amplicons variable between the maternal parent and candidate DH were fractionated by capillary electrophoresis as above. 48 markers identified as heterozygous in the maternal parent (Table 5) were applied to the DH candidate to assess homozygosity.
Table 4

Microsatellite markers used to screen for heterozygosity on the maternal parent (palm BL013/12-06) of DH candidate palm (0644-219/05049582C).

No

Marker

Forward Primer (5'-3')

Reverse Primer (5'-3')

1

VS1

GAGATTACAAAGTCCAAACC

TCAAAATTAAGAAAGTATGC

2

OPSSR 3

ACGCATGCAGCTAGCTTTTC

CGCGTGAAAGATATGAATCAAC

3

OPSSR 7

CACGCACGCAGTTTATTCTT

GGATGTATGCTTTACCTCCGAAT

4

OPSSR 8

CCCCTTTTGCTTCCCTATTT

CTCCTTTTCCCCATCACAGA

5

OPSSR 9

GACACAAGCAAAAACAAAAGCA

ATTCTGAAAGGAGGGGGAAA

6

OPSSR 14

ATATGTGTGGGTGTGCGTGT

TGCCTCTGGTTGTTAGTCTGG

7

OPSSR 19

TCTCTCTCTCTCTCTCTATGTGTGTGT

TGGCAATCAGCACACATTCT

8

OPSSR 29

GCAGCTCTTTCCACACCTCT

TGTGGTCTCCTGAGGAAGATG

9

OPSSR 30

TTTTCCCCATCACAGAATTG

CCCCTTTTGCTTCCCTATTT

10

OPSSR32

GAACAAAACGGGAAGAAGCA

CCTCAAATGGGAGAAACCAG

11

mEgUWA07

CGGATAGAGGCAGCAAGACT

CTCGGGTTGTTTAACCCATT

12

mEgUWA44

TTGAGACGTCGTTCCTTTCC

AGCGGAGACCCAATAATCCT

13

mEgUWA50

CCTGCAACTGCAAATGAGAC

TCCAGACACAAACTACACACACC

14

mEgCIR0037

Published by Billotte et al. [27]

15

mEgCIR0055

Published by Billotte et al. [27]

16

mEgCIR0059

Published by Billotte et al. [27]

17

mEgCIR0067

Published by Billotte et al. [28]

18

mEgCIR0074

Published by Billotte et al. [27]

19

mEgCIR0146

Published by Billotte et al. [27]

20

mEgCIR0163

Published by Billotte et al. [27]

21

mEgCIR0173

Published by Billotte et al. [27]

22

mEgCIR0177

Published by Billotte et al. [27]

23

mEgCIR0192

Published by Billotte et al. [27]

24

mEgCIR0195

Published by Billotte et al. [27]

25

mEgCIR0243

Published by Billotte et al. [27]

26

mEgCIR0246

Published by Billotte et al. [27]

27

mEgCIR0257

Published by Billotte et al. [27]

28

mEgCIR0268

Published by Billotte et al. [27]

29

mEgCIR0328

Published by Billotte et al. [27]

30

mEgCIR0359

Published by Billotte et al. [27]

31

mEgCIR0366

Published by Billotte et al. [27]

32

mEgCIR0369

Published by Billotte et al. [27]

33

mEgCIR0380

Published by Billotte et al. [27]

34

mEgCIR0399

Published by Billotte et al. [27]

35

mEgCIR0408

Published by Billotte et al. [27]

36

mEgCIR0409

Published by Billotte et al. [27]

37

mEgCIR0425

Published by Billotte et al. [27]

38

mEgCIR0433

Published by Billotte et al. [27]

39

mEgCIR0439

Published by Billotte et al. [27]

40

mEgCIR0445

Published by Billotte et al. [27]

41

mEgCIR0446

Published by Billotte et al. [27]

42

mEgCIR0465

Published by Billotte et al. [27]

43

mEgCIR0521

Published by Billotte et al. [27]

44

mEgCIR0551

Published by Billotte et al. [27]

45

mEgCIR0555

Published by Billotte et al. [27]

46

mEgCIR0588

Published by Billotte et al. [27]

47

mEgCIR0772

Published by Billotte et al. [27]

48

mEgCIR0773

Published by Billotte et al. [27]

49

mEgCIR0774

Published by Billotte et al. [27]

50

mEgCIR0775

Published by Billotte et al. [27]

51

mEgCIR0778

Published by Billotte et al. [27]

52

mEgCIR0779

Published by Billotte et al. [27]

53

mEgCIR0781

Published by Billotte et al. [27]

54

mEgCIR0786

Published by Billotte et al. [27]

55

mEgCIR0787

Published by Billotte et al. [27]

56

mEgCIR0788

Published by Billotte et al. [27]

57

mEgCIR0790

Published by Billotte et al. [27]

58

mEgCIR0793

Published by Billotte et al. [27]

59

mEgCIR0800

Published by Billotte et al. [27]

60

mEgCIR0801

Published by Billotte et al. [27]

61

mEgCIR0802

Published by Billotte et al. [27]

62

mEgCIR0803

Published by Billotte et al. [27]

63

mEgCIR0804

Published by Billotte et al. [27]

64

mEgCIR0825

Published by Billotte et al. [27]

65

mEgCIR0827

Published by Billotte et al. [27]

66

mEgCIR0844

Published by Billotte et al. [27]

67

mEgCIR0874

Published by Billotte et al. [27]

68

mEgCIR0878

Published by Billotte et al. [27]

69

mEgCIR0882

Published by Billotte et al. [27]

70

mEgCIR0886

Published by Billotte et al. [27]

71

mEgCIR0894

Published by Billotte et al. [27]

72

mEgCIR0905

Published by Billotte et al. [27]

73

mEgCIR0906

Published by Billotte et al. [27]

74

mEgCIR0910

Published by Billotte et al. [27]

75

mEgCIR0912

Published by Billotte et al. [27]

76

mEgCIR1729

Published by Billotte et al. [27]

77

mEgCIR1740

Published by Billotte et al. [27]

78

mEgCIR1753

Published by Billotte et al. [27]

79

mEgCIR1773

Published by Billotte et al. [27]

80

mEgCIR1917

Published by Billotte et al. [27]

81

mEgCIR1977

Published by Billotte et al. [27]

82

mEgCIR1996

Published by Billotte et al. [27]

83

mEgCIR2110

Published by Billotte et al. [27]

84

mEgCIR2144

Published by Billotte et al. [27]

85

mEgCIR2149

Published by Billotte et al. [27]

86

mEgCIR2188

Published by Billotte et al. [27]

87

mEgCIR2212

Published by Billotte et al. [27]

88

mEgCIR2215

Published by Billotte et al. [27]

89

mEgCIR2380

Published by Billotte et al. [27]

90

mEgCIR2387

Published by Billotte et al. [27]

91

mEgCIR2414

Published by Billotte et al. [27]

92

mEgCIR2417

Published by Billotte et al. [27]

93

mEgCIR2422

Published by Billotte et al. [27]

94

mEgCIR2423

Published by Billotte et al. [27]

95

mEgCIR2427

Published by Billotte et al. [27]

96

mEgCIR2436

Published by Billotte et al. [27]

97

mEgCIR2440

Published by Billotte et al. [27]

98

mEgCIR2492

Published by Billotte et al. [27]

99

mEgCIR2518

Published by Billotte et al. [27]

100

mEgCIR2525

Published by Billotte et al. [27]

101

mEgCIR2569

Published by Billotte et al. [27]

102

mEgCIR2575

Published by Billotte et al. [27]

103

mEgCIR2577

Published by Billotte et al. [27]

104

mEgCIR2590

Published by Billotte et al. [27]

105

mEgCIR2595

Published by Billotte et al. [27]

106

mEgCIR2600

Published by Billotte et al. [27]

107

mEgCIR2621

Published by Billotte et al. [27]

108

mEgCIR2628

Published by Billotte et al. [27]

109

mEgCIR2763

Published by Billotte et al. [27]

110

mEgCIR2813

Published by Billotte et al. [27]

111

mEgCIR2860

Published by Billotte et al. [27]

112

mEgCIR2887

Published by Billotte et al. [27]

113

mEgCIR2893

Published by Billotte et al. [27]

114

mEgCIR3040

Published by Billotte et al. [27]

115

mEgCIR3111

Published by Billotte et al. [27]

116

mEgCIR3160

Published by Billotte et al. [27]

117

mEgCIR3194

Published by Billotte et al. [27]

118

mEgCIR3213

Published by Billotte et al. [27]

119

mEgCIR3232

Published by Billotte et al. [27]

120

mEgCIR3295

Published by Billotte et al. [27]

121

mEgCIR3296

Published by Billotte et al. [27]

122

mEgCIR3297

Published by Billotte et al. [27]

123

mEgCIR3298

Published by Billotte et al. [27]

124

mEgCIR3300

Published by Billotte et al. [27]

125

mEgCIR3301

Published by Billotte et al. [27]

126

mEgCIR3305

Published by Billotte et al. [27]

127

mEgCIR3307

Published by Billotte et al. [27]

128

mEgCIR3310

Published by Billotte et al. [27]

129

mEgCIR3311

Published by Billotte et al. [27]

130

mEgCIR3316

Published by Billotte et al. [27]

131

mEgCIR3321

Published by Billotte et al. [27]

132

mEgCIR3328

Published by Billotte et al. [27]

133

mEgCIR3350

Published by Billotte et al. [27]

134

mEgCIR3384

Published by Billotte et al. [27]

135

mEgCIR3389

Published by Billotte et al. [27]

136

mEgCIR3399

Published by Billotte et al. [27]

137

mEgCIR3400

Published by Billotte et al. [27]

138

mEgCIR3402

Published by Billotte et al. [27]

139

mEgCIR3427

Published by Billotte et al. [27]

140

mEgCIR3428

Published by Billotte et al. [27]

141

mEgCIR3433

Published by Billotte et al. [27]

142

mEgCIR3439

Published by Billotte et al. [27]

143

mEgCIR3477

Published by Billotte et al. [27]

144

mEgCIR3519

Published by Billotte et al. [27]

145

mEgCIR3526

Published by Billotte et al. [27]

146

mEgCIR3533

Published by Billotte et al. [27]

147

mEgCIR3534

Published by Billotte et al. [27]

148

mEgCIR3535

Published by Billotte et al. [27]

149

mEgCIR3538

Published by Billotte et al. [27]

150

mEgCIR3543

Published by Billotte et al. [27]

151

mEgCIR3544

Published by Billotte et al. [27]

152

mEgCIR3546

Published by Billotte et al. [27]

153

mEgCIR3555

Published by Billotte et al. [27]

154

mEgCIR3557

Published by Billotte et al. [27]

155

mEgCIR3563

Published by Billotte et al. [27]

156

mEgCIR3567

Published by Billotte et al. [27]

157

mEgCIR3569

Published by Billotte et al. [27]

158

mEgCIR3574

Published by Billotte et al. [27]

159

mEgCIR3587

Published by Billotte et al. [27]

160

mEgCIR3590

Published by Billotte et al. [27]

161

mEgCIR3592

Published by Billotte et al. [27]

162

mEgCIR3593

Published by Billotte et al. [27]

163

mEgCIR3607

Published by Billotte et al. [27]

164

mEgCIR3622

Published by Billotte et al. [27]

165

mEgCIR3633

Published by Billotte et al. [27]

166

mEgCIR3639

Published by Billotte et al. [27]

167

mEgCIR3643

Published by Billotte et al. [27]

168

mEgCIR3649

Published by Billotte et al. [27]

169

mEgCIR3653

Published by Billotte et al. [27]

170

mEgCIR3655

Published by Billotte et al. [27]

171

mEgCIR3663

Published by Billotte et al. [27]

172

mEgCIR3668

Published by Billotte et al. [27]

173

mEgCIR3672

Published by Billotte et al. [27]

174

mEgCIR3683

Published by Billotte et al. [27]

175

mEgCIR3684

Published by Billotte et al. [27]

176

mEgCIR3691

Published by Billotte et al. [27]

177

mEgCIR3693

Published by Billotte et al. [27]

178

mEgCIR3696

Published by Billotte et al. [27]

179

mEgCIR3698

Published by Billotte et al. [27]

180

mEgCIR3705

Published by Billotte et al. [27]

181

mEgCIR3711

Published by Billotte et al. [27]

182

mEgCIR3716

Published by Billotte et al. [27]

183

mEgCIR3718

Published by Billotte et al. [27]

184

mEgCIR3722

Published by Billotte et al. [27]

185

mEgCIR3727

Published by Billotte et al. [27]

186

mEgCIR3728

Published by Billotte et al. [27]

187

mEgCIR3732

Published by Billotte et al. [27]

188

mEgCIR3737

Published by Billotte et al. [27]

189

mEgCIR3739

Published by Billotte et al. [27]

190

mEgCIR3745

Published by Billotte et al. [27]

191

mEgCIR3747

Published by Billotte et al. [27]

192

mEgCIR3750

Published by Billotte et al. [27]

193

mEgCIR3755

Published by Billotte et al. [27]

194

mEgCIR3766

Published by Billotte et al. [27]

195

mEgCIR3769

Published by Billotte et al. [27]

196

mEgCIR3775

Published by Billotte et al. [27]

197

mEgCIR3782

Published by Billotte et al. [27]

198

mEgCIR3785

Published by Billotte et al. [27]

199

mEgCIR3787

Published by Billotte et al. [27]

200

mEgCIR3788

Published by Billotte et al. [27]

201

mEgCIR3792

Published by Billotte et al. [27]

202

mEgCIR3807

Published by Billotte et al. [27]

203

mEgCIR3808

Published by Billotte et al. [27]

204

mEgCIR3809

Published by Billotte et al. [27]

205

mEgCIR3813

Published by Billotte et al. [27]

206

mEgCIR3819

Published by Billotte et al. [27]

207

mEgCIR3825

Published by Billotte et al. [27]

208

mEgCIR3826

Published by Billotte et al. [27]

209

mEgCIR3828

Published by Billotte et al. [27]

210

mEgCIR3847

Published by Billotte et al. [27]

211

mEgCIR3850

Published by Billotte et al. [27]

212

mEgCIR3869

Published by Billotte et al. [27]

Table 5

Markers shown to be heterozygous in the maternal parent (palm BL013/12-06) and homozygous in the DH candidate (0644-219/05049582C).

No

Marker

Linkage Group

1

mEgCIR0268

1

2

mEgCIR0874

1

3

mEgCIR3847

1

4

mEgCIR2149

2

5

mEgCIR2518

3

6

mEgCIR0425

3

7

mEgCIR3544

3

8

mEgCIR3716

4

9

mEgCIR1917

4

10

mEgCIR3535

4

11

mEgCIR3310

4

12

mEgCIR3705

4

13

mEgCIR3477

4

14

mEgCIR0059

4

15

mEgCIR3557

4

16

mEgCIR2813

5

17

mEgCIR3543

6

18

mEgCIR0195

6

19

mEgCIR0894

7

20

mEgCIR0905b

7

21

mEgCIR0774

8

22

mEgCIR2440

8

23

mEgCIR0825

10

24

mEgCIR3826

10

25

mEgCIR0788

10

26

mEgCIR2628

10

27

mEgCIR0146

10

28

mEgCIR0878

11

29

mEgCIR1773

12

30

mEgCIR3311

12

31

mEgCIR0779

14

32

mEgCIR0588

14

33

mEgCIR3737

15

34

mEgCIR3850

15

35

mEgCIR3639

16

36

mEgCIR0905a

16

37

mEgCIR3739

unlinked

38

mEgCIR3160

unmapped

39

mEgCIR3360

unmapped

40

mEgCIR0801

unmapped

41

mEgCIR2577

unmapped

42

OPSSR14

unmapped

43

OPSSR30

unmapped

44

OPSSR32

unmapped

45

mEgUWA44

unmapped

46

mEgUWA50

unmapped

47

mEgUWA07

unmapped

48

VS1

unmapped

Linkage group assigned according to Billotte et al. [27].

DH candidate 0644-219/05049582C was found to be homozygous across all 48 loci that were heterozygous in its maternal parent. Of these 48 loci, 36 have been mapped by Billotte et al. [27] (Table 5). We first considered the probability of obtaining the observed homozygosity levels via independent assortment using only the unlinked markers from this group. For unlinked loci, the probability of homozygous offspring arising by independent assortment is 0.5 per locus. Given that heterozygous loci were secured from 14 of the 16 linkage groups, with the addition of a further unlinked (unassigned) marker, the probability of these markers all becoming homozygous by chance is therefore: P = 0.515 = 0.000030517578125.

This figure was further reduced by the inclusion of the remaining 21 markers that had been assigned a map position [27]. Here, linkage was accommodated by multiplying by 1-(distance in cM/100). Thus the inclusion of a new marker 10 cM from an existing marker would mean multiplying the cumulative total by 1- (10/100) = 1-0.1 = 0.9 (rather than 0.5 for an unlinked marker). This reduced the probability as follows:
P = 0.0000 3 0 517578125 × ( extra markers from Linkage Group 1 ,  LG1 ) 0. 92 × 0. 92 × ( extra markers from LG3 ) 0. 81 × 0. 93 × ( LG4 ) 0. 86 × 0. 62 × 0. 55 × 0. 88 × 0. 95 × 0. 87 × ( LG6 ) 0. 9 × ( LG7 ) 0. 93 × ( LG8 ) 0. 52 × ( LG1 0 ) 0. 93 × 0. 94 × 0. 87 × 0. 83 × ( LG12 ) 0. 5 × ( LG14 ) 0. 5 × ( LG15 ) 0. 6 × ( LG16 ) 0. 51 = 8 . 72 × 1 0 8 .

Flow Cytometry

Newly matured leaflets or radicles from candidate H/DH palms were subjected to flow cytometry according to Anumaganathan & Earle [29] to establish ploidy level. Commercial tenera palms were included as diploid controls. For high-throughput mass screening, tissue samples were bulked at a rate of five individual tissue samples per bulk. Bulked samples (about 0.5 cm2 for radicles and 1 cm2 for leaf material (per each individual) were sliced by chopping with a sharp clean razor-blade (20-30 chops), in a plastic 9 cm diameter Petri dish containing 1.5 ml of cold (5°C) CyStain® UV Ploidy solution (Partec, Germany) modified by addition of 6.48 mM dithiothreitol (DTT) and 1% (v/v) polyvinylpyrrolidone (PVP-40) (Sigma-Aldrich, USA). The addition of DTT and PVP-40 were found to reduce background counts ('noise') in output histograms of particle fluorescence in the analyte.

Confirmation of Hs by chromosome squashes

Harvested roots were pre-treated in iced water (24 h), then fixed in 3:1 v/v alcohol: glacial acetic acid at 4°C (24 h). They were then rinsed in water, softened in 1N HCl (20 min), rinsed in water (2 min) and stained in saturated aceto-orcein (1 min). The root tip was then squashed, mounted onto a glass slide, and examined using a compound photomicroscope.

Principal Coordinates Analysis

The genetic affinity of 270 Hs was compared with 95 representative diploids (Table 6) using 28 microsatellites (Table 7) by Principal Coordinates Analysis (PCoA). The PCoA was constructed using GenAlEx v6 [30]. Genetic distance option 'codominant-genotypic' was applied, where pairwise, individual-by-individual (N × N) genetic distances are calculated for codominant data. For a single-locus analysis, with i-th, j-th, k-th and l-th different alleles, a set of squared distances is defined as d2(ii, ii) = 0, d2(ij, ij) = 0, d2(ii, ij) = 1, d2(ij, ik) = 1, d2(ij, kl) = 2, d2(ii, jk) = 3, and d2(ii, jj) = 4. The algorithm used in GenAlEx is based on Orloci [31] using distance matrix with standardization (by dividing the distance inputs by the square root of n-1). Here, Hs were treated as the DHs they were assumed to generate; thus genotypes were homozygous not hemizygous.
Table 6

Identification codes, oil palm type and ploidy level of oil palm genotypes used in the Principal Coordinates Analysis

No

Label no in PCO

Sample name in PCO

Palm Id

Ploidy level

1

1

haploid

05020271_0001

x

2

2

haploid

05050099_0001

x

3

3

haploid

05050099_0002

x

4

4

haploid

05020961_0001

x

5

5

haploid

05020511_0001

x

6

6

haploid

05020946_0001

x

7

8

haploid

05030147_0001

x

8

9

haploid

05030462_0001

x

9

10

haploid

05020420_0002

x

10

11

haploid

05020361_0001

x

11

12

haploid

05030060_0001

x

12

13

haploid

05020558_0001

x

13

14

haploid

05020631_0001

x

14

15

haploid

05040748_0003

x

15

16

haploid

05030308_0001

x

16

18

haploid

05080318_0003

x

17

19

haploid

06020186_0001

x

18

20

haploid

05110212_0001

x

19

21

haploid

05120555_0001

x

20

22

haploid

06011022_0001

x

21

23

haploid

05020059_0001

x

22

24

haploid

06020320_0004

x

23

25

haploid

06020571_0004

x

24

26

haploid

06020381_0001

x

25

27

haploid

05060119_0001

x

26

28

haploid

05090172_0001

x

27

30

haploid

05100321_0001

x

28

31

haploid

06010670_0006

x

29

32

haploid

06010842_0004

x

30

33

haploid

05050228_0001

x

31

34

haploid

05110260_0001

x

32

35

haploid

05110260_0002

x

33

36

haploid

05110162_0001

x

34

37

haploid

05101030_0001

x

35

38

haploid

05040273_0001

x

36

39

haploid

05110003_0001

x

37

40

haploid

05120002_0001

x

38

41

haploid

05080095_0001

x

39

43

haploid

06110122_0002

x

40

44

haploid

05110716_0001

x

41

45

haploid

05010836_0001

x

42

46

haploid

05120155_0001

x

43

47

haploid

05110875_0001

x

44

48

haploid

05070553_0001

x

45

49

haploid

05070466_0001

x

46

50

haploid

06010650_0001

x

47

51

haploid

05110718_0001

x

48

52

haploid

05110496_0001

x

49

53

haploid

06010107_0001

x

50

54

haploid

05120429_0002

x

51

55

haploid

06010953_0001

x

52

56

haploid

05030686_0001

x

53

57

haploid

05060107_0001

x

54

58

haploid

05030791_0001

x

55

59

haploid

05080585_0001

x

56

60

haploid

05020375_0001

x

57

61

haploid

05121048_0001

x

58

62

haploid

05055090_0001

x

59

63

haploid

05121004_0002

x

60

64

haploid

06030064_0001

x

61

65

haploid

05121061_0004

x

62

66

haploid

05060276_0001

x

63

67

haploid

05100988_0001

x

64

68

haploid

05060315_0001

x

65

69

haploid

06030324_0003

x

66

70

haploid

05080506_0001

x

67

71

haploid

06010813_0001

x

68

72

haploid

05110881_0001

x

69

73

haploid

05100717_0001

x

70

74

haploid

06020169_0009

x

71

75

haploid

05110134_0001

x

72

76

haploid

05030196_0001

x

73

77

haploid

05050220_0001

x

74

78

haploid

06011195_0001

x

75

79

haploid

05120725_0001

x

76

80

haploid

05100510_0001

x

77

81

haploid

05060624_0001

x

78

82

haploid

05060712_0001

x

79

83

haploid

05030150_0001

x

80

84

haploid

06030180_0001

x

81

85

haploid

06020915_0001

x

82

86

haploid

05101150_0003

x

83

87

haploid

05101152_0001

x

84

88

haploid

05020415_0001

x

85

89

haploid

05040029_0002

x

86

90

haploid

05040035_0003

x

87

91

haploid

06020573_0001

x

88

93

haploid

05121112_0008

x

89

94

haploid

05090078_0001

x

90

95

haploid

05060495_0001

x

91

96

haploid

05070484_0001

x

92

97

haploid

06020455_0001

x

93

98

haploid

05075185_0001

x

94

99

haploid

05090522_0004

x

95

100

haploid

06020625_0002

x

96

101

haploid

05100812_0002

x

97

102

haploid

05100862_0001

x

98

103

haploid

05030224_0002

x

99

104

haploid

05040439_0001

x

100

105

haploid

05040317_0003

x

101

106

haploid

05080030_0001

x

102

107

haploid

05070703_0003

x

103

108

haploid

05080485_0001

x

104

109

haploid

05110470_0002

x

105

110

haploid

05100423_0001

x

106

111

haploid

05110423_0001

x

107

112

haploid

05080362_0003

x

108

113

haploid

05110625_0001

x

109

114

haploid

05120719_0001

x

110

115

haploid

05121073_0002

x

111

116

haploid

06050726_0002

x

112

117

haploid

06060063_0001

x

113

119

haploid

06121220_0001

x

114

120

haploid

06080516_0001

x

115

121

haploid

06090505_0002

x

116

122

haploid

06090407_0004

x

117

123

haploid

06051133_0002

x

118

124

haploid

06060740_0031

x

119

125

haploid

06060740_0077

x

120

126

haploid

06060740_0090

x

121

127

haploid

06120178_0001

x

122

128

haploid

06090960_0003

x

123

129

haploid

06090657_0001

x

124

130

haploid

06120377_0001

x

125

131

haploid

06070208_0001

x

126

132

haploid

07010308_0001

x

127

133

haploid

06121125_0001

x

128

134

haploid

06121125_0002 A

x

129

135

haploid

06121125_0002 B

x

130

136

haploid

06019052_0005

x

131

137

haploid

06129197_0001

x

132

138

haploid

06079077_0001

x

133

139

haploid

07019130_0003

x

134

140

haploid

06075474_0001

x

135

141

haploid

06075474_0003

x

136

142

haploid

06075544_0001

x

137

143

haploid

06045801_0001

x

138

144

haploid

06065285_0001

x

139

145

haploid

06081027_0001

x

140

146

haploid

06090264_0001

x

141

147

haploid

06090264_0002

x

142

148

haploid

06070430_0001

x

143

149

haploid

06090861_0001

x

144

150

haploid

06051245_0001

x

145

151

haploid

06070716_0001

x

146

152

haploid

06051468_0001

x

147

153

haploid

06075617_0001

x

148

154

haploid

06040273_0001

x

149

155

haploid

06080584_0001

x

150

156

haploid

06070825_0001

x

151

158

haploid

06110390_0015

x

152

159

haploid

06031385_0001

x

153

160

haploid

06045657_0001

x

154

161

haploid

06110204_0008

x

155

162

haploid

06050161_0001

x

156

163

haploid

06071068_0010

x

157

164

haploid

06100785_0002

x

158

165

haploid

06010987_0028

x

159

166

haploid

07010166_0001

x

160

167

haploid

06100730_0001

x

161

168

haploid

06080681_0001

x

162

169

haploid

06080532_0005

x

163

170

haploid

06040024_0001

x

164

172

haploid

06080217_0010

x

165

173

haploid

06120975_0001

x

166

174

haploid

06070581_0002

x

167

175

haploid

06060477_0001

x

168

176

haploid

06120852_0001

x

169

177

haploid

06091392_0001

x

170

178

haploid

06060344_0001

x

171

179

haploid

06090211_0001

x

172

180

haploid

06100858_0001

x

173

181

haploid

06080272_0007

x

174

182

haploid

06050493_0004

x

175

183

haploid

06101033_0002

x

176

184

haploid

06081043_0001

x

177

185

haploid

07011057_0001

x

178

186

haploid

06070921_0001

x

179

187

haploid

06111210_0002

x

180

188

haploid

06121495_0001

x

181

189

haploid

06110610_0001

x

182

190

haploid

06090772_0001

x

183

191

haploid

06090318_0002

x

184

192

haploid

06121313_0001

x

185

193

haploid

06085027_0001

x

186

194

haploid

06090109_0001

x

187

195

haploid

06080157_0001

x

188

196

haploid

06121316_0001

x

189

197

haploid

06110900_0001

x

190

198

haploid

06070228_0002

x

191

199

haploid

06101174_0001

x

192

200

haploid

06060805_0001

x

193

201

haploid

06085063_0001

x

194

202

haploid

06101037_0001

x

195

203

haploid

06110444_0002

x

196

204

haploid

06101487_0001

x

197

205

haploid

06100937_0001

x

198

206

haploid

06090820_0002

x

199

207

haploid

06070039_0001

x

200

208

haploid

06070772_0001

x

201

209

haploid

07011408_0001

x

202

210

haploid

07011408_0002

x

203

211

haploid

06100319_0001

x

204

212

haploid

06070468_0001

x

205

213

haploid

06121385_0002

x

206

214

haploid

06100537_0001

x

207

215

haploid

06120726_0001

x

208

216

haploid

06070883_0001

x

209

217

haploid

06040041_0001

x

210

218

haploid

06100263_0001

x

211

219

haploid

06040043_0009

x

212

220

haploid

06101232_0001

x

213

221

haploid

06060189_0003

x

214

222

haploid

06091275_0002

x

215

223

haploid

06060097_0001

x

216

224

haploid

06100873_0001

x

217

225

haploid

06050038_0001

x

218

226

haploid

06100025_0001

x

219

227

haploid

06100940_0002

x

220

228

haploid

06040800_0001

x

221

229

haploid

06071007_0002

x

222

230

haploid

06020043_0026

x

223

231

haploid

06060811_0153

x

224

232

haploid

06080751_0001

x

225

233

haploid

06050178_0068

x

226

234

haploid

06040287_0001

x

227

236

haploid

06101496_0001

x

228

237

haploid

06040643_0001

x

229

238

haploid

06045788_0003

x

230

239

haploid

06050326_0001

x

231

240

haploid

06080649_0002

x

232

241

haploid

06080649_0003

x

233

242

haploid

06080601_0001

x

234

243

haploid

06101247_0001

x

235

244

haploid

06111271_0001

x

236

245

haploid

06090337_0001

x

237

246

haploid

06050125_0002

x

238

247

haploid

06050331_0001

x

239

248

haploid

06060728_0002

x

240

249

haploid

06080109_0001

x

241

250

haploid

06101048_0001

x

242

251

haploid

06051077_0001

x

243

253

haploid

06041067_0003

x

244

254

haploid

06040302_0002

x

245

255

haploid

06110121_0001

x

246

256

haploid

06090845_0001

x

247

257

haploid

06060375_0001

x

248

258

haploid

06070494_0001

x

249

259

haploid

06040938_0003

x

250

260

haploid

06081010_0001

x

251

261

haploid

06070415_0003

x

252

263

haploid

07010776_0001

x

253

264

haploid

06120890_0001

x

254

265

haploid

06120316_0001

x

255

266

haploid

06121413_0001

x

256

267

haploid

06090247_0001

x

257

268

haploid

06090247_0002

x

258

269

haploid

06090801_0001

x

259

270

haploid

06041160_0002

x

260

271

haploid

06031248_0001

x

261

272

haploid

07010075_0001

x

262

273

haploid

07011039_0001

x

263

274

haploid

06041232_0001

x

264

275

haploid

06101271_0002

x

265

276

haploid

06060506_0001

x

266

277

haploid

06080566_0001

x

267

278

haploid

06060124_0001

x

268

279

haploid

07020168_0001

x

269

281

haploid

06090909_0002

x

270

282

haploid

06080869_0001

x

271

1

commercial pisifera

BL605/39-04

2x

272

2

commercial pisifera

BL607/91-10

2x

273

3

commercial pisifera

BL612/84-05

2x

274

4

commercial pisifera

BL1120/75-07

2x

275

5

commercial pisifera

BL143/04-10

2x

276

6

commercial pisifera

BL147/21-05

2x

277

7

commercial pisifera

BL148/05-08

2x

278

8

commercial pisifera

BL158/A2-13

2x

279

1

commercial tenera

BL10452/207-02

2x

280

2

commercial tenera

BL10323/104-06

2x

281

3

commercial tenera

BL1177/184-09

2x

282

1

commercial dura

BL10887/08-22

2x

283

2

commercial dura

BL10885/08-27

2x

284

3

commercial dura

BL1221/51-14

2x

285

4

commercial dura

BL1222/32-02

2x

286

5

commercial dura

BL1224/14-19

2x

287

6

commercial dura

BL1231/02-01

2x

288

7

commercial dura

BL1235/14-01

2x

289

8

commercial dura

BL1125/03-02

2x

290

9

commercial dura

BL1124/17-09

2x

291

10

commercial dura

BL1136/01-02

2x

292

11

commercial dura

BL10868/12-10

2x

293

12

commercial dura

BL10868/12-11

2x

294

13

commercial dura

BL10868/12-13

2x

295

14

commercial dura

BL10879/08-06

2x

296

15

commercial dura

BL10879/08-07

2x

297

16

commercial dura

BL10879/08-09

2x

298

17

commercial dura

BL10883/04-06

2x

299

18

commercial dura

BL10883/04-08

2x

300

19

commercial dura

BL10883/04-09

2x

301

20

commercial dura

BL10883/05-06

2x

302

21

commercial dura

BL10891/04-23

2x

303

22

commercial dura

BL10891/04-24

2x

304

23

commercial dura

BL10891/05-22

2x

305

24

commercial dura

BL10891/05-23

2x

306

25

commercial dura

BL10873/52-18

2x

307

26

commercial dura

BL10873/52-19

2x

308

27

commercial dura

BL10873/52-21

2x

309

28

commercial dura

BL10873/53-19

2x

310

29

commercial dura

BL1229/48-15

2x

311

30

commercial dura

BL1230/42-15

2x

312

31

commercial dura

A1122/04-01

2x

313

32

commercial dura

A1122/12-05

2x

314

33

commercial dura

A1122/12-08

2x

315

34

commercial dura

A1122/36-02

2x

316

35

commercial dura

A1123/01-02

2x

317

36

commercial dura

A1123/01-06

2x

318

37

commercial dura

A1123/01-07

2x

319

38

commercial dura

A1123/01-12

2x

320

39

commercial dura

A1130/02-02

2x

321

40

commercial dura

A1130/02-06

2x

322

41

commercial dura

A1130/02-10

2x

323

42

commercial dura

A1130/02-16

2x

324

43

commercial dura

A1127/08-16

2x

325

44

commercial dura

A1127/08-06

2x

326

45

commercial dura

A1127/05-11

2x

327

46

commercial dura

A1127/05-03

2x

328

47

commercial dura

B1134/35-09

2x

329

48

commercial dura

B1133/07-10

2x

330

49

commercial dura

B1136/21-11

2x

331

50

commercial dura

B1136/21-12

2x

332

51

commercial dura

C1128/07-14

2x

333

52

commercial dura

C1121/13-08

2x

334

53

commercial dura

BL11508/111-1

2x

335

54

commercial dura

BL11396/11-21

2x

336

1

Ghana wild

K31-1/GHANA/1-1

2x

337

2

Ghana wild

K31-1/GHANA/41-498

2x

338

3

Ghana wild

K31-1/GHANA/39-875

2x

339

4

Ghana wild

K31-1/GHANA/31-430

2x

340

5

Ghana wild

K31-1/GHANA/26-629

2x

341

6

Ghana wild

K31-1/GHANA/24-1164

2x

342

7

Ghana wild

K31-1/GHANA/56-1185

2x

343

8

Ghana wild

K31-1/GHANA/29-1087

2x

344

9

Ghana wild

K31-1/GHANA/38-1193

2x

345

10

Ghana wild

K31-1/GHANA/43-994

2x

346

11

Ghana wild

K31-1/GHANA/8-1100

2x

347

12

Ghana wild

K31-1/GHANA/11-1192

2x

348

13

Ghana wild

K31-1/GHANA/35-1190

2x

349

14

Ghana wild

K31-1/GHANA/3-46

2x

350

15

Ghana wild

K31-1/GHANA/5-102

2x

351

16

Ghana wild

K31-1/GHANA/7-121

2x

352

17

Ghana wild

K31-1/GHANA/12-239

2x

353

18

Ghana wild

K31-1/GHANA/14-350

2x

354

19

Ghana wild

K31-1/GHANA/18-368

2x

355

20

Ghana wild

K31-1/GHANA/19-245

2x

356

21

Ghana wild

K31-1/GHANA/21-1180

2x

357

22

Ghana wild

K31-1/GHANA/32-1141

2x

358

23

Ghana wild

K31-1/GHANA/37-1124

2x

359

24

Ghana wild

K31-1/GHANA/45-448

2x

360

25

Ghana wild

K31-1/GHANA/47-1175

2x

361

26

Ghana wild

K31-1/GHANA/50-1037

2x

362

27

Ghana wild

K31-1/GHANA/52-547

2x

363

28

Ghana wild

K31-1/GHANA/53-1167

2x

364

29

Ghana wild

K31-1/GHANA/54-1196

2x

365

30

Ghana wild

K31-1/GHANA/57-1153

2x

Table 7

Primer pairs used in the Principal Coordinates Analysis to compare the genetic diversity and affinities of Hs compared with a representative sample of commercial and wild diploid palms (listed in Table 6).

No

Primer

Forward (5'-3')

Reverse (5'-3')

1

1996

CACTGGGGTCATCTTCATCT

TCGTTCTCTTTCCTTTTGTC

2

2215

GAACTTGGCGTGTAACT

TGGTAGGTCTATTTGAGAGT

3

2427

GAAGGGGCATTGGATTT

CAGGTGACCAAGTGTAAT

4

2569

TAGCCGCACTCCCACGAAGC

CCAGAATCATCAGACTCGGACAG

5

2595

TCAAAGAGCCGCACAACAAG

ACTTTGCTGCTTGGTGACTTA

6

2600

GGGGATGAGTTTGTTTGTTC

GGCAACATGAAGGTAAG

7

3282

GTAACAGCATCCACACTAAC

GCAGGACAGGAGTAATGAGT

8

3298

GACTACCGTATTGCGTTCAG

TTTATCAGGAGTTTTTGTTTGAGAG

9

3311

AATCCAAGTGGCCTACAG

TCCCTACAATAGCCATCTC

10

3321

CAAGGAGGAGCAGGTGAG

TACGGCCTCGGTTCTACAC

11

3399

AGCCAATGAAGGATAAAGG

CCACTTAGAGGTAAAACAACAG

12

3400

CAATTCCAGCGTFAFTATAG

AGTGGCAGTGGAAAAACAGT

13

3433

GGTTCAATGGCATACAT

ACTCCCCTCTTTGACAT

14

3538

TCAAGCCACATCCTAACTAC

CTCATAGCCTTTGTTGTGT

15

3544

AGCAGGGCAAGAGCAATACT

TTCAGCAGCAGGAAACATC

16

3546

GCCTATCCCCTGAACTATCT

TGCACATACCAGCAACAGAG

17

3574

AGAGACCCTATTTGCTTGAT

GACAAAGAGCTTGTCACAC

18

3711

GTCTCATGTGGCTACCTCTC

GCTAGGTGAAAAATAAAGTT

19

3819

CCTCCTTTGGAATTATG

GTGTTTGATGGGACATACA

20

219

TTTGCTCGGCGGATACAT

GGAGGGCAGGAACAAAAAGT

21

257

GCAGCTAGTCACCTGAAC

GACGAGACTGGAAAGATG

22

782

CGTTCATCCCACCACCTTTC

GCTGCGAGGCCACTGATAC

23

783

GAATGTGGCTGTAAATGCTGAGTG

AAGCCGCATGGACAACTCTAGTAA

24

882

TTGATCTTAGACATAACATACTGTA

AAAGCGCGTAATCTCATAGT

25

894

TGCTTCTTGTCCTTGATACA

CCACGTCTACGAAATGATAA

26

3213

GCTCTTTGTATTTCCTGGTTC

AGCAGCAAACCCTACTAACT

27

3691

GCATCATTGGACTATCATACC

TTGTGAACCAGGGAACTATC

28

vs1

GAGATTACAAAGTCCAAACC

TCAAAATTAAGAAAGTATGC

All primers except VS1 were taken from Billotte et al. [27].

Colchicine treatment

Roots of confirmed haploid seedlings were washed and immersed in 2.5, 5.0, 7.5, or 10 mM aqueous colchicine for 5 h. Seedlings were then rinsed with water and planted (2:1:1 v/v compost, sand and soil).

Cross-fertilization using pollen from H plants

A developing male inflorescence of a confirmed H at the PMC stage was treated with 2.5 mM colchicine via injection into the spathe. This treatment was repeated at weekly intervals. The resultant pollen (0.03 g) was applied to a targeted section of the female inflorescence of a diploid dura palm. The inflorescence was then bagged to prevent inadvertent wind pollination.

In addition, some untreated H plants contained up to 30% fully stained pollen using Fluorescein diacetate (FDA) that was presumed to be viable. Pollen from these plants and from palms with apparently inviable pollen (unstained) was applied to targeted sections of a female inflorescence of diploid dura palms in the same way as above.

Notes

Declarations

Acknowledgements

This work was funded by Sumatra Bioscience as part of their R&D programme in oil palm. The authors are grateful for the assistance of all staff of the Breeding Department and Seed Production Unit at Bah Lias Research Station, Indonesia.

Authors’ Affiliations

(1)
School of Biological Sciences, University of Reading
(2)
Institute of Biological, Environmental and Rural Sciences, Aberystwyth University
(3)
Sumatra Bioscience Pte Ltd
(4)
PT Sumatra Bioscience
(5)
BioHybrids International Ltd
(6)
Instituto de Biología Vegetal y Biotecnología, Universidad de Talca

References

  1. Duvick DN: Biotechnology in the 1930s: the development of hybrid maize. Nature Rev Genet. 2001, 2: 69-73. 10.1038/35047587.PubMedView Article
  2. Horie T, Shiraiwa T, Homma K, Katsura K, Maeda S, Yoshida H: Can yields of lowland rice resume the increases that they showed in the 1980s?. Plant Prod Sci. 2005, 8: 259-274. 10.1626/pps.8.259.View Article
  3. Forster BP, Thomas WTB: Doubled haploids in genetics and plant breeding. Plant Breeding Rev. 2005, 25: 57-88.
  4. Cook RR: A haploid Marglobe tomato. J Hered. 1936, 27: 433-435.
  5. Maluszynski M, Kasha KJ, Szarejko I: Published protocols for other crop plant species. Doubled Haploid Production in Crop Plants: A Manual. Edited by: Maluszynski M, Kasha KJ, Forster BP, Szarejko I. Dordrecht:Kluwer; 2003:309-335.View Article
  6. Dunwell JM: Haploids in flowering plants: origins and exploitation. Plant Biotech J. 2010, 8: 377-424. 10.1111/j.1467-7652.2009.00498.x.View Article
  7. Kelly-Yong TL, Lee KT, Mohamed AR, Bhatia S: Potential of hydrogen from oil palm biomass as a source of renewable energy worldwide. Energ Policy. 2007, 35: 5692-5701. 10.1016/j.enpol.2007.06.017.View Article
  8. Basiron Y: Palm oil production through sustainable plantations. Eur J Lipid Sci Technol. 2007, 109: 289-295. 10.1002/ejlt.200600223.View Article
  9. Food and Agriculture Organization of the United Nations. Agricultural Production Statistics. [http://faostat.fao.org/]
  10. Stone R: Ecology - Can palm oil plantations come clean?. Science. 2007, 317: 1491-10.1126/science.317.5844.1491.PubMedView Article
  11. Wilcove DS, Koh LP: Addressing the threats to biodiversity from oil-palm agriculture. Biodivers Conserv. 2010, 19: 999-1007. 10.1007/s10531-009-9760-x.View Article
  12. Koh LP, Wilcove DS: Cashing in palm oil for conservation. Nature. 2007, 448: 993-994. 10.1038/448993a.PubMedView Article
  13. Clements R, Posa MRC: Conservationists could slip up in oil-palm enterprise. Nature. 2007, 449: 403-10.1038/449403d.PubMedView Article
  14. Venter O, Meijaard E, Wilson K: Strategies and alliances needed to protect forest from palm-oil industry. Nature. 2008, 451: 16-10.1038/451016a.PubMedView Article
  15. Corley RHV: Potential productivity of tropical perennial crops. Exp Agric. 1983, 19: 217-237. 10.1017/S0014479700022742.View Article
  16. Murphy DJ: Oil palm: future prospects for yield and quality improvements. Lipid Technology. 2009, 21: 257-260. 10.1002/lite.200900067.View Article
  17. Jones LH: Prospects for biotechnology in oil palm (Elaeis guineensis) and coconut (Cocos nucifera) improvement. Biotech Genet Engin Rev. 1989, 7: 281-296.View Article
  18. Whitehead RA, Chapman GP: Twinning and haploidy in Cocos nucifera. Nature. 1962, 195: 1228-1229. 10.1038/1951228a0.View Article
  19. Bouvier L, Zhang YX, Lespinasse Y: Two methods of haploidization in pear, Pyrus communis L.: greenhouse seedling selection and in situ parthenogenesis induced by irradiated pollen. Theor Appl Genet. 1993, 87: 229-232. 10.1007/BF00223769.PubMedView Article
  20. Germana MA: Haploids and doubled haploids in fruit trees. Advances in Haploid Production in Higher Plants. Edited by: Touraev A, Forster BP, Jain SM. The Netherlands: Springer-Verlag; 2009:241-263. full_text.View Article
  21. Lim W, Earle ED: Enhanced recovery of doubled haploid lines from parthenogenetic plants of melon. Plant Cell Tiss Org. 2009, 98: 351-356. 10.1007/s11240-009-9563-5.View Article
  22. Finkel E: With 'phenomics,' plant scientists hope to shift plant breeding into overdrive. Science. 2009, 325: 380-381. 10.1126/science.325_380.PubMedView Article
  23. Reijnders L, Huijbregts MAJ: Palm oil and the emission of carbon-based greenhouse gases. J Clean Product. 2008, 16: 477-482. 10.1016/j.jclepro.2006.07.054.View Article
  24. Parveez GKA: Biolistic mediated production of transgenic oil palm. Method Mol Biol. 2009, 477: 301-320. full_text.View Article
  25. Persson UM, Azar C: Preserving the world's tropical forests - a price on carbon may not do. Environ Sci Technol. 2010, 44: 210-215. 10.1021/es902629x.PubMedView Article
  26. Croxford AE, Rogers T, Caligari PDS, Wilkinson MJ: High-resolution melt analysis to identify and map sequence-tagged site anchor points onto linkage maps: a white lupin (Lupinus albus) map as an exemplar. New Phytol. 2008, 180: 594-607. 10.1111/j.1469-8137.2008.02588.x.PubMedView Article
  27. Billotte N, Marseillac N, Risterucci AM, Adon B, Brottier P, Baurens FC, Singh R, Herran A, Asmady H, Billot C, Amblard P, Durand-Gasselin T, Courtois B, Asmono D, Cheah SC, Rohde W, Ritter E, Charrier A: Microsatellite-based high density linkage map in oil palm (Elaeis guineensis Jacq.). Theor Appl Genet. 2005, 110: 754-765. 10.1007/s00122-004-1901-8.PubMedView Article
  28. Billotte N, Risterucci AM, Barcelos E, Noyer JL, Amblard P, Baurens FC: Development, characterisation, and across-taxa utility of oil palm (Elaeis guineensis Jacq.) microsatellite markers. Genome. 2001, 44: 413-425. 10.1139/gen-44-3-413.PubMedView Article
  29. Arumuganathan K, Earle ED: Estimation of nuclear DNA content of plants by flow cytometry. Plant Mol Biol Rep. 1991, 9: 221-231.View Article
  30. Peakall R, Smouse PE: GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes. 2006, 6: 288-295. 10.1111/j.1471-8286.2005.01155.x.View Article
  31. Orloci L: Multivariate analysis in vegetation research. Boston: The Hague, 2 1978.

Copyright

© Dunwell et al; licensee BioMed Central Ltd. 2010

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement