BMC Plant Biology 2010, 10:195doi:10.1186/1471-2229-10-195 Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait
CORRECTION: In the Methods, under the subsection FAD2-1B allele specific molecular marker assay, incorrect primer sequences were inadvertently listed: Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'-ACTGCATCGAATAATACAAGCC-3' at 2 μM final concentration, and 5'-TGATATTGTCCCGTCCAGC-3' at 5 μM final concentration).
The correct sentence should read: Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'- GGTTCTCCAAGGTTGCATTCTTACT -3' at 2 μM final concentration, and 5'- AGGGTTGTTCAGGTACTTGGTGT -3' at 5 μM final concentration).
CORRECTION
7 September 2011
BMC Plant Biology 2010, 10:195doi:10.1186/1471-2229-10-195
Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait
CORRECTION:
In the Methods, under the subsection FAD2-1B allele specific molecular marker assay, incorrect primer sequences were inadvertently listed:
Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'-ACTGCATCGAATAATACAAGCC-3' at 2 μM final concentration, and 5'-TGATATTGTCCCGTCCAGC-3' at 5 μM final concentration).
The correct sentence should read:
Genotyping reactions were performed with a 5:2 asymmetric mix of primers (5'- GGTTCTCCAAGGTTGCATTCTTACT -3' at 2 μM final concentration, and 5'- AGGGTTGTTCAGGTACTTGGTGT -3' at 5 μM final concentration).
Kristin Bilyeu
31 August 2011
Competing interests
No competing interests.